diablo, IAP-binding mitochondrial protein (DIABLO) - coding DNA reference sequence

(used for variant description)

(last modified April 30, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_019887.5 in the DIABLO gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_029459.1, covering DIABLO transcript NM_019887.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5025
                       gagctcggggaccacgcggaggttgtaattggtctcta       c.-781

 .         .         .         .         .         .                g.5085
 gaccacacctagttgttgagtgccgctgcttgaaaatctcagttctgccgagatcgcaga       c.-721

 .         .         .         .         .         .                g.5145
 atacacacaagctacctttgggcaccagagcagacagaaccgcggagcttcagggtggaa       c.-661

 .         .         . | 02       .         .         .             g.5907
 gattcgtggaaactttgccaa | ggccaggacctcgtgtgttcccgtccgcccctctgggac    c.-601

 .         .         .         .         .         .                g.5967
 ggcgccagcccggcaggccgccgaccgtcctggggctcccgcgcagcgcgatgccggcct       c.-541

 .         .         .         .         .         .                g.6027
 cgtccaccgtccacgtgctgcagctgctgcgggagctgctcgccttcgtgctcctcagct       c.-481

 .         .         .         .         .         .                g.6087
 acacggtgctcatcggggcgctgctgctggccggctggaccacttacttcctggtgctga       c.-421

 .         .         .         .         .         .                g.6147
 agtgacagcgccgtcgccgcgcccggccccgcctcccgcccggccccgcctcccgcccgg       c.-361

 .         .         .         .         .         .                g.6207
 ccccgcctccctaactcaccaggaaattcccttcaagccctggcccgaactgagtccccg       c.-301

 .         .         .         .         .         .                g.6267
 cccacccgccagcgtcacggcgcccgactcagctccgcgccggacccacctccgcgccct       c.-241

 .         .         .         .         .         .                g.6327
 caggccctgcatatgccccgccccgcgcggaagttccggcggttggttgccttgcgcggc       c.-181

 .         .         .         .         .         .                g.6387
 cgttacagcctttgccctaagcctcgccccctttccccctgcctgcccaatcccgactgc       c.-121

 .         .         .         .         .         .                g.6447
 ttccttgggtgggggcgtggctatggggcgaggcgctctcaggtggaggccgtgccccgc       c.-61

 .         .         .         .         .         .                g.6507
 tccgcgctcacgaagctgcgtcacttccggcgtgtgcgtctggcgtccgcgcgctgcaca       c.-1

          .         .         .         .         . | 03       .    g.7887
 ATGGCGGCTCTGAAGAGTTGGCTGTCGCGCAGCGTAACTTCATTCTTCAG | GTACAGACAG    c.60
 M  A  A  L  K  S  W  L  S  R  S  V  T  S  F  F  R  |  Y  R  Q      p.20

          .         .         .         .         .         .       g.7947
 TGTTTGTGTGTTCCTGTTGTGGCTAACTTTAAGAAGCGGTGTTTCTCAGAATTGATAAGA       c.120
 C  L  C  V  P  V  V  A  N  F  K  K  R  C  F  S  E  L  I  R         p.40

          .         .         .         .         .         .       g.8007
 CCATGGCACAAAACTGTGACGATTGGCTTTGGAGTAACCCTGTGTGCGGTTCCTATTGCA       c.180
 P  W  H  K  T  V  T  I  G  F  G  V  T  L  C  A  V  P  I  A         p.60

     | 04    .         .         .         .         .         .    g.14181
 CAG | AAATCAGAGCCTCATTCCCTTAGTAGTGAAGCATTGATGAGGAGAGCAGTGTCTTTG    c.240
 Q   | K  S  E  P  H  S  L  S  S  E  A  L  M  R  R  A  V  S  L      p.80

          .         .         .         .         .         .       g.14241
 GTAACAGATAGCACCTCTACCTTTCTCTCTCAGACCACATATGCGTTGATTGAAGCTATT       c.300
 V  T  D  S  T  S  T  F  L  S  Q  T  T  Y  A  L  I  E  A  I         p.100

          .      | 05  .         .         .         .         .    g.15697
 ACTGAATATACTAAG | GCTGTTTATACCTTAACTTCTCTTTACCGACAATATACAAGTTTA    c.360
 T  E  Y  T  K   | A  V  Y  T  L  T  S  L  Y  R  Q  Y  T  S  L      p.120

          .         .         .         .         .         .       g.15757
 CTTGGGAAAATGAATTCAGAGGAGGAAGATGAAGTGTGGCAGGTGATCATAGGAGCCAGA       c.420
 L  G  K  M  N  S  E  E  E  D  E  V  W  Q  V  I  I  G  A  R         p.140

        | 06 .         .         .         .         .         .    g.15991
 GCTGAG | ATGACTTCAAAACACCAAGAGTACTTGAAGCTGGAAACCACTTGGATGACTGCA    c.480
 A  E   | M  T  S  K  H  Q  E  Y  L  K  L  E  T  T  W  M  T  A      p.160

          .         .         .         .    | 07    .         .    g.23961
 GTTGGTCTTTCAGAGATGGCAGCAGAAGCTGCATATCAAACTG | GCGCAGATCAGGCCTCT    c.540
 V  G  L  S  E  M  A  A  E  A  A  Y  Q  T  G |   A  D  Q  A  S      p.180

          .         .         .         .         .         .       g.24021
 ATAACCGCCAGGAATCACATTCAGCTGGTGAAACTGCAGGTGGAAGAGGTGCACCAGCTC       c.600
 I  T  A  R  N  H  I  Q  L  V  K  L  Q  V  E  E  V  H  Q  L         p.200

          .         .         .         .         .         .       g.24081
 TCCCGGAAAGCAGAAACCAAGCTGGCAGAAGCACAGATAGAAGAGCTCCGTCAGAAAACA       c.660
 S  R  K  A  E  T  K  L  A  E  A  Q  I  E  E  L  R  Q  K  T         p.220

          .         .         .         .         .         .       g.24141
 CAGGAGGAAGGGGAGGAGCGGGCTGAGTCGGAGCAGGAGGCCTACCTGCGTGAGGATTGA       c.720
 Q  E  E  G  E  E  R  A  E  S  E  Q  E  A  Y  L  R  E  D  X         p.239

          .         .         .         .         .         .       g.24201
 gggcctgagcacactgccctgtctccccactcagtggggaaagcaggggcagatgccacc       c.*60

          .         .         .         .         .         .       g.24261
 ctgcccagggttggcatgactgtctgtgcaccgagaagaggcggcagatcctgccctggc       c.*120

          .         .         .         .         .         .       g.24321
 caatcaggcgagacgcctttgtgagctgtgagtgcctcctgtggtctcaggcttgcgctg       c.*180

          .         .         .         .         .         .       g.24381
 gacctggttcttagcccttgggcactgcaccctgtttaacatttcaccccactctgtaca       c.*240

          .         .         .         .         .         .       g.24441
 gctgctcttacccattttttttacctcacacccaaagcattttgcctacctgggtcagag       c.*300

          .         .         .         .         .         .       g.24501
 agaggagtcctttttgtcatgcccttaagttcagcaactgtttaacctgttttcagtctt       c.*360

          .         .         .         .         .         .       g.24561
 atttacgtcgtcaaaaatgatttagtacttgttccctctgttgggatgccagttgtggca       c.*420

          .         .         .         .         .         .       g.24621
 gggggaggggaacctgtccagtttgtacgatttctttgtatgtatttctgatgtgttctc       c.*480

          .         .         .         .         .         .       g.24681
 tgatctgcccccactgtcctgtgaggacagctgaggccaaggagtgaaaaacctattact       c.*540

          .         .         .         .         .         .       g.24741
 actaagagaaggggtgcagagtgtttacctggtgctctcaacaggacttaacatcaacag       c.*600

          .         .         .         .         .         .       g.24801
 gacttaacacaggcctcttgttccttcctttctttccgtttctctattgtatccaaagga       c.*660

          .         .         .         .         .                 g.24860
 gaagagtgtaagattttgtttgcatctgaaagagaaaatgcgtctctcctggggtccta        c.*719

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Diablo, IAP-binding mitochondrial protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.