distal-less homeobox 5 (DLX5) - coding DNA reference sequence

(used for variant description)

(last modified April 28, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_005221.5 in the DLX5 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009220.1, covering DLX5 transcript NM_005221.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 agcagtcagccggccggagacagagact       c.-181

 .         .         .         .         .         .                g.5088
 tcacgactcccagtctcctcctcgccgcggccgccgcctcctccttctctcctcctcctc       c.-121

 .         .         .         .         .         .                g.5148
 ttcctcctcctccctcgctcccacagccatgtctgcttagaccagagcagccccacagcc       c.-61

 .         .         .         .         .         .                g.5208
 aactagggcagctgccgccgccacaacagcaaggacagccgctgccgccgcccgtgagcg       c.-1

          .         .         .         .         .         .       g.5268
 ATGACAGGAGTGTTTGACAGAAGGGTCCCCAGCATCCGATCCGGCGACTTCCAAGCTCCG       c.60
 M  T  G  V  F  D  R  R  V  P  S  I  R  S  G  D  F  Q  A  P         p.20

          .         .         .         .         .         .       g.5328
 TTCCAGACGTCCGCAGCTATGCACCATCCGTCTCAGGAATCGCCAACTTTGCCCGAGTCT       c.120
 F  Q  T  S  A  A  M  H  H  P  S  Q  E  S  P  T  L  P  E  S         p.40

          .         .         .         .         .         .       g.5388
 TCAGCTACCGATTCTGACTACTACAGCCCTACGGGGGGAGCCCCGCACGGCTACTGCTCT       c.180
 S  A  T  D  S  D  Y  Y  S  P  T  G  G  A  P  H  G  Y  C  S         p.60

          .         .         .         .         .         .       g.5448
 CCTACCTCGGCTTCCTATGGCAAAGCTCTCAACCCCTACCAGTATCAGTATCACGGCGTG       c.240
 P  T  S  A  S  Y  G  K  A  L  N  P  Y  Q  Y  Q  Y  H  G  V         p.80

          .         .         .         .         .         .       g.5508
 AACGGCTCCGCCGGGAGCTACCCAGCCAAAGCTTATGCCGACTATAGCTACGCTAGCTCC       c.300
 N  G  S  A  G  S  Y  P  A  K  A  Y  A  D  Y  S  Y  A  S  S         p.100

          .         .         .         .         .      | 02  .    g.7467
 TACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACCAGCCAG | AGAAA    c.360
 Y  H  Q  Y  G  G  A  Y  N  R  V  P  S  A  T  N  Q  P  E |   K      p.120

          .         .         .         .         .         .       g.7527
 GAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAGTTCGTAAACCC       c.420
 E  V  T  E  P  E  V  R  M  V  N  G  K  P  K  K  V  R  K  P         p.140

          .         .         .         .         .         .       g.7587
 AGGACTATTTATTCCAGCTTTCAGCTGGCCGCATTACAGAGAAGGTTTCAGAAGACTCAG       c.480
 R  T  I  Y  S  S  F  Q  L  A  A  L  Q  R  R  F  Q  K  T  Q         p.160

          .         .         .         .         .         .       g.7647
 TACCTCGCCTTGCCGGAACGCGCCGAGCTGGCCGCCTCGCTGGGATTGACACAAACACAG       c.540
 Y  L  A  L  P  E  R  A  E  L  A  A  S  L  G  L  T  Q  T  Q         p.180

  | 03       .         .         .         .         .         .    g.8826
  | GTGAAAATCTGGTTTCAGAACAAAAGATCCAAGATCAAGAAGATCATGAAAAACGGGGAG    c.600
  | V  K  I  W  F  Q  N  K  R  S  K  I  K  K  I  M  K  N  G  E      p.200

          .         .         .         .         .         .       g.8886
 ATGCCCCCGGAGCACAGTCCCAGCTCCAGCGACCCAATGGCGTGTAACTCGCCGCAGTCT       c.660
 M  P  P  E  H  S  P  S  S  S  D  P  M  A  C  N  S  P  Q  S         p.220

          .         .         .         .         .         .       g.8946
 CCAGCGGTGTGGGAGCCCCAGGGCTCGTCCCGCTCGCTCAGCCACCACCCTCATGCCCAC       c.720
 P  A  V  W  E  P  Q  G  S  S  R  S  L  S  H  H  P  H  A  H         p.240

          .         .         .         .         .         .       g.9006
 CCTCCGACCTCCAACCAGTCCCCAGCGTCCAGCTACCTGGAGAACTCTGCATCCTGGTAC       c.780
 P  P  T  S  N  Q  S  P  A  S  S  Y  L  E  N  S  A  S  W  Y         p.260

          .         .         .         .         .         .       g.9066
 ACAAGTGCAGCCAGCTCAATCAATTCCCACCTGCCGCCGCCGGGCTCCTTACAGCACCCG       c.840
 T  S  A  A  S  S  I  N  S  H  L  P  P  P  G  S  L  Q  H  P         p.280

          .         .         .                                     g.9096
 CTGGCGCTGGCCTCCGGGACACTCTATTAG                                     c.870
 L  A  L  A  S  G  T  L  Y  X                                       p.289

          .         .         .         .         .         .       g.9156
 atgggctgctctctcttactctcttttttgggactactgtgttttgctgttctagaaaat       c.*60

          .         .         .         .         .         .       g.9216
 cataaagaaaggaattcatatggggaagttcggaaaactgaaaaagattcatgtgtaaag       c.*120

          .         .         .         .         .         .       g.9276
 cttttttttgcatgtaagttattgcatttcaaaagaccccccctttttttacagaggact       c.*180

          .         .         .         .         .         .       g.9336
 ttttttgcgcaactgtggacactttcaatggtgccttgaaatctatgacctcaacttttc       c.*240

          .         .         .         .         .         .       g.9396
 aaaagacttttttcaatgttattttagccatgtaaataagtgtagatagaggaattaaac       c.*300

          .         .         .         .                           g.9442
 tgtatattctggataaataaaattatttcgaccatgaaaagcggaa                     c.*346

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Distal-less homeobox 5 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.