dimethylglycine dehydrogenase (DMGDH) - coding DNA reference sequence

(used for variant description)

(last modified March 3, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_013391.3 in the DMGDH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012164.1, covering DMGDH transcript NM_013391.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5006
       aggctgcccgctggcctcggagcaggcgcctgcgccctcggcctcggcctagtc       c.-1

          .         .         .         .         .         .       g.5066
 ATGCTCCGTCCCGGCGCGCAGCTGCTGCGGGGCCTCCTGCTGCGGAGCTGCCCGCTGCAG       c.60
 M  L  R  P  G  A  Q  L  L  R  G  L  L  L  R  S  C  P  L  Q         p.20

          .         .         .         .  | 02      .         .    g.10858
 GGCTCCCCCGGGCGCCCGCGCTCTGTCTGCGGCCGGGAAGG | AGAGGAAAAACCACCCTTA    c.120
 G  S  P  G  R  P  R  S  V  C  G  R  E  G  |  E  E  K  P  P  L      p.40

          .         .         .         .         .         .       g.10918
 TCTGCAGAAACACAATGGAAAGACAGAGCAGAAACAGTGATAATTGGAGGTGGCTGTGTT       c.180
 S  A  E  T  Q  W  K  D  R  A  E  T  V  I  I  G  G  G  C  V         p.60

          .         .         .         .         .         .       g.10978
 GGTGTGAGTCTGGCTTATCACCTGGCCAAAGCAGGGATGAAAGATGTGGTCCTGCTGGAG       c.240
 G  V  S  L  A  Y  H  L  A  K  A  G  M  K  D  V  V  L  L  E         p.80

          .         .         .       | 03 .         .         .    g.18742
 AAATCAGAGCTCACGGCTGGATCTACCTGGCACGCA | GCAGGTTTAACAACTTACTTTCAT    c.300
 K  S  E  L  T  A  G  S  T  W  H  A   | A  G  L  T  T  Y  F  H      p.100

          .         .         .         .         .         .       g.18802
 CCTGGAATAAACTTGAAGAAAATACATTATGATAGCATCAAACTTTATGAGAAACTGGAA       c.360
 P  G  I  N  L  K  K  I  H  Y  D  S  I  K  L  Y  E  K  L  E         p.120

          .      | 04  .         .         .         .         .    g.20323
 GAAGAAACTGGTCAG | GTGGTGGGATTCCATCAGCCAGGTAGTATCAGACTTGCTACCACC    c.420
 E  E  T  G  Q   | V  V  G  F  H  Q  P  G  S  I  R  L  A  T  T      p.140

          .         .         .         .         .         .       g.20383
 CCTGTAAGGGTAGATGAATTTAAATATCAAATGACTCGGACTGGCTGGCATGCAACAGAA       c.480
 P  V  R  V  D  E  F  K  Y  Q  M  T  R  T  G  W  H  A  T  E         p.160

          .         .         .         .         .         .       g.20443
 CAGTATCTCATTGAACCTGAAAAAATTCAAGAGATGTTCCCTTTACTCAACATGAATAAG       c.540
 Q  Y  L  I  E  P  E  K  I  Q  E  M  F  P  L  L  N  M  N  K         p.180

  | 05       .         .         .         .         .         .    g.23195
  | GTTTTAGCTGGATTGTATAATCCTGGAGATGGTCACATTGATCCTTATTCTCTAACTATG    c.600
  | V  L  A  G  L  Y  N  P  G  D  G  H  I  D  P  Y  S  L  T  M      p.200

          .         .         .         .         .         .       g.23255
 GCACTGGCTGCTGGGGCTAGGAAATGTGGTGCCCTTTTAAAATATCCTGCACCAGTAACT       c.660
 A  L  A  A  G  A  R  K  C  G  A  L  L  K  Y  P  A  P  V  T         p.220

          .         .         .         .         .         .       g.23315
 TCTCTGAAAGCCAGGTCAGATGGAACATGGGACGTTGAAACACCACAGGGGTCTATGAGA       c.720
 S  L  K  A  R  S  D  G  T  W  D  V  E  T  P  Q  G  S  M  R         p.240

          .         .      | 06  .         .         .         .    g.30109
 GCAAATAGAATTGTGAATGCTGCAG | GATTTTGGGCTCGTGAAGTAGGTAAAATGATTGGA    c.780
 A  N  R  I  V  N  A  A  G |   F  W  A  R  E  V  G  K  M  I  G      p.260

          .         .         .         .         .         .       g.30169
 CTAGAACATCCTCTCATTCCGGTTCAACATCAATATGTTGTTACATCGACTATATCTGAA       c.840
 L  E  H  P  L  I  P  V  Q  H  Q  Y  V  V  T  S  T  I  S  E         p.280

          .         .         .         .         .         .       g.30229
 GTGAAAGCTTTGAAACGAGAACTGCCTGTGCTCCGTGACCTGGAAGGATCATATTATCTC       c.900
 V  K  A  L  K  R  E  L  P  V  L  R  D  L  E  G  S  Y  Y  L         p.300

          .         .         .         .         .         .       g.30289
 CGACAGGAAAGGGATGGGCTTTTGTTTGGTCCATATGAAAGTCAAGAGAAAATGAAAGTT       c.960
 R  Q  E  R  D  G  L  L  F  G  P  Y  E  S  Q  E  K  M  K  V         p.320

          .         .         .     | 07   .         .         .    g.32171
 CAGGACTCCTGGGTCACCAATGGAGTTCCTCCAG | GTTTTGGAAAGGAACTCTTTGAGTCT    c.1020
 Q  D  S  W  V  T  N  G  V  P  P  G |   F  G  K  E  L  F  E  S      p.340

          .         .         .         .         .         .       g.32231
 GATCTAGATCGAATCATGGAACACATCAAAGCTGCCATGGAAATGGTTCCTGTCTTGAAA       c.1080
 D  L  D  R  I  M  E  H  I  K  A  A  M  E  M  V  P  V  L  K         p.360

          .         .         .         .         .         .       g.32291
 AAGGCTGACATCATCAATGTTGTCAATGGTCCTATCACGTATTCTCCTGACATTCTGCCT       c.1140
 K  A  D  I  I  N  V  V  N  G  P  I  T  Y  S  P  D  I  L  P         p.380

          .         .         .         .         .    | 08    .    g.41225
 ATGGTGGGGCCCCATCAGGGGGTCAGAAACTACTGGGTGGCTATAGGCTTTGG | ATATGGC    c.1200
 M  V  G  P  H  Q  G  V  R  N  Y  W  V  A  I  G  F  G  |  Y  G      p.400

          .         .         .         .         .         .       g.41285
 ATAATCCACGCTGGTGGGGTAGGGAAATATCTCAGTGACTGGATCCTGCATGGAGAACCT       c.1260
 I  I  H  A  G  G  V  G  K  Y  L  S  D  W  I  L  H  G  E  P         p.420

          .         .         .         .         .         .       g.41345
 CCTTTTGATCTGATAGAATTGGATCCTAATCGCTATGGCAAATGGACAACAACCCAGTAC       c.1320
 P  F  D  L  I  E  L  D  P  N  R  Y  G  K  W  T  T  T  Q  Y         p.440

          .         .         .         .    | 09    .         .    g.41803
 ACTGAGGCCAAAGCAAGAGAATCATATGGATTCAACAATATTG | TTGGTTATCCTAAAGAA    c.1380
 T  E  A  K  A  R  E  S  Y  G  F  N  N  I  V |   G  Y  P  K  E      p.460

          .         .         .         .         .         .       g.41863
 GAACGGTTTGCTGGGAGGCCGACTCAACGAGTCAGTGGGCTCTATCAAAGGCTGGAGTCT       c.1440
 E  R  F  A  G  R  P  T  Q  R  V  S  G  L  Y  Q  R  L  E  S         p.480

          .         .         .         .         .         .       g.41923
 AAGTGTTCCATGGGGTTCCATGCTGGCTGGGAGCAGCCGCACTGGTTCTACAAACCAGGC       c.1500
 K  C  S  M  G  F  H  A  G  W  E  Q  P  H  W  F  Y  K  P  G         p.500

          .        | 10.         .         .         .         .    g.43671
 CAGGACACTCAGTACAG | GCCAAGTTTTCGCCGCACAAACTGGTTTGAGCCTGTGGGCTCG    c.1560
 Q  D  T  Q  Y  R  |  P  S  F  R  R  T  N  W  F  E  P  V  G  S      p.520

          .         .         .         .         .         .       g.43731
 GAGTATAAACAGGTTATGCAAAGAGTAGCGGTAACTGACCTATCACCATTTGGCAAGTTT       c.1620
 E  Y  K  Q  V  M  Q  R  V  A  V  T  D  L  S  P  F  G  K  F         p.540

          .         .         .         .         .         .       g.43791
 AACATCAAAGGCCAAGATTCCATTAGACTACTGGACCATCTCTTTGCAAATGTCATTCCA       c.1680
 N  I  K  G  Q  D  S  I  R  L  L  D  H  L  F  A  N  V  I  P         p.560

     | 11    .         .         .         .         .         .    g.44649
 AAG | GTGGGTTTTACAAATATAAGTCACATGTTAACACCCAAGGGTCGAGTGTATGCTGAG    c.1740
 K   | V  G  F  T  N  I  S  H  M  L  T  P  K  G  R  V  Y  A  E      p.580

          .         .         .         .         .         .       g.44709
 CTGACTGTTTCTCACCAATCTCCTGGGGAGTTTCTTTTAATTACTGGCTCTGGATCAGAA       c.1800
 L  T  V  S  H  Q  S  P  G  E  F  L  L  I  T  G  S  G  S  E         p.600

          .     | 12   .         .         .         .         .    g.46022
 CTTCATGATCTTAG | ATGGATTGAAGAAGAAGCAGTCAAAGGTGGATATGATGTTGAAATT    c.1860
 L  H  D  L  R  |  W  I  E  E  E  A  V  K  G  G  Y  D  V  E  I      p.620

          .         .         .         .         .         .       g.46082
 AAAAACATAACTGATGAGCTTGGAGTTCTTGGAGTTGCTGGGCCACAGGCAAGAAAGGTC       c.1920
 K  N  I  T  D  E  L  G  V  L  G  V  A  G  P  Q  A  R  K  V         p.640

          .         .         .         .         .         .       g.46142
 CTTCAGAAACTGACCTCTGAAGATCTTAGTGATGATGTTTTCAAGTTTCTTCAAACCAAG       c.1980
 L  Q  K  L  T  S  E  D  L  S  D  D  V  F  K  F  L  Q  T  K         p.660

          .         .         .         .         .   | 13     .    g.48053
 TCCTTAAAGGTTTCCAACATTCCTGTCACTGCTATTAGGATATCTTATACTG | GTGAGCTG    c.2040
 S  L  K  V  S  N  I  P  V  T  A  I  R  I  S  Y  T  G |   E  L      p.680

          .         .         .         .         .         .       g.48113
 GGTTGGGAGCTGTATCACAGAAGAGAAGATTCTGTGGCGCTGTATGACGCTATCATGAAT       c.2100
 G  W  E  L  Y  H  R  R  E  D  S  V  A  L  Y  D  A  I  M  N         p.700

          .         .         .         .         .         .       g.48173
 GCAGGCCAGGAGGAGGGAATCGACAATTTTGGAACCTATGCCATGAATGCCTTACGCCTG       c.2160
 A  G  Q  E  E  G  I  D  N  F  G  T  Y  A  M  N  A  L  R  L         p.720

          .         .         . | 14       .         .         .    g.50326
 GAGAAAGCCTTCAGAGCCTGGGGGTTAGAG | ATGAACTGTGATACAAATCCTTTGGAAGCT    c.2220
 E  K  A  F  R  A  W  G  L  E   | M  N  C  D  T  N  P  L  E  A      p.740

          .         .         . | 15       .         .         .    g.69249
 GGACTGGAATATTTTGTGAAGTTAAATAAG | CCAGCAGACTTCATAGGAAAGCAAGCACTG    c.2280
 G  L  E  Y  F  V  K  L  N  K   | P  A  D  F  I  G  K  Q  A  L      p.760

          .         .         .         .         .         .       g.69309
 AAACAGATTAAAGCCAAGGGGCTGAAACGAAGACTGGTCTGCCTCACCTTGGCAACGGAT       c.2340
 K  Q  I  K  A  K  G  L  K  R  R  L  V  C  L  T  L  A  T  D         p.780

          .         .         .         .      | 16  .         .    g.76344
 GATGTTGATCCAGAGGGAAATGAAAGCATCTGGTACAATGGCAAG | GTGGTTGGCAACACG    c.2400
 D  V  D  P  E  G  N  E  S  I  W  Y  N  G  K   | V  V  G  N  T      p.800

          .         .         .         .         .         .       g.76404
 ACATCTGGAAGCTATAGCTACAGCATCCAGAAGAGTCTGGCTTTCGCATATGTCCCTGTA       c.2460
 T  S  G  S  Y  S  Y  S  I  Q  K  S  L  A  F  A  Y  V  P  V         p.820

          .         .         .         .         .         .       g.76464
 CAACTAAGTGAAGTGGGACAGCAAGTGGAAGTTGAACTATTAGGCAAAAATTACCCAGCA       c.2520
 Q  L  S  E  V  G  Q  Q  V  E  V  E  L  L  G  K  N  Y  P  A         p.840

          .         .         .         .         .         .       g.76524
 GTCATCATACAAGAACCTTTGGTATTGACCGAACCAACCAGAAACCGGCTTCAGAAAAAA       c.2580
 V  I  I  Q  E  P  L  V  L  T  E  P  T  R  N  R  L  Q  K  K         p.860

          .         .                                               g.76545
 GGTGGAAAGGACAAAACTTGA                                              c.2601
 G  G  K  D  K  T  X                                                p.866

          .         .         .         .         .         .       g.76605
 aaaaagaccttcagcagtcaactgaattagagttgctaatgactgtccttgaaattatta       c.*60

          .         .         .         .         .         .       g.76665
 taactggctcccaggggaatagaggaaaccaggaattcatttcaaaatcatcaaagtcta       c.*120

          .         .         .         .         .         .       g.76725
 aatttagaatcttaatgaaacctttctgttaagtgttttctaagcaagacagaataatag       c.*180

          .         .         .         .         .         .       g.76785
 ataaatgatttacattgttcttttaaatgaagaaatttgaaatgaatgtttttttattta       c.*240

          .         .         .         .         .         .       g.76845
 ccccacattacccaatcagtaaaacatttaggtgtttgctaatatacacaatcattacta       c.*300

          .         .         .         .         .         .       g.76905
 taacctaattaagggacattttataattttagtaacaaatgcattcggttcttgacagct       c.*360

          .         .         .         .         .         .       g.76965
 gaaaacaaattaataaattatcttttacataaaaacatgtacaatattgtttatggattt       c.*420

          .         .         .         .         .         .       g.77025
 acttctttgagaaatctttccttagatgaataaatgaaagttttaatttttcatgatata       c.*480

          .         .         .                                     g.77063
 tctgtgatgaaaatagtaaaacttaacattgacatata                             c.*518

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Dimethylglycine dehydrogenase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center