DnaJ (Hsp40) homolog, subfamily C, member 12 (DNAJC12) - coding DNA reference sequence

(used for variant description)

(last modified January 6, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_021800.2 in the DNAJC12 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering DNAJC12 transcript NM_021800.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5048
             aaaggtctaggatgacatctggtgtattgactgtggccagtcttaaag       c.-121

 .         .         .         .         .         .                g.5108
 ctagtttttgctatgtggaacatgctgctctaattcagatttaaagagtttcttcctgtt       c.-61

 .         .         .         .         .         .                g.5168
 aattcgaagctcactgtgcctcttgtttccgagggaagaaggactgattaagtcatctaa       c.-1

          .         .         .         .         .         .       g.5228
 ATGGATGCAATACTGAATTACAGGTCAGAAGATACTGAAGATTACTACACATTACTGGGA       c.60
 M  D  A  I  L  N  Y  R  S  E  D  T  E  D  Y  Y  T  L  L  G         p.20

          .         | 02         .         .         .         .    g.19829
 TGTGATGAACTATCTTCG | GTTGAACAAATCCTGGCAGAATTTAAAGTCAGAGCTCTGGAA    c.120
 C  D  E  L  S  S   | V  E  Q  I  L  A  E  F  K  V  R  A  L  E      p.40

          .         .         .        | 03.         .         .    g.31539
 TGTCACCCAGACAAGCATCCTGAAAACCCCAAAGCTG | TGGAGACTTTTCAGAAACTGCAG    c.180
 C  H  P  D  K  H  P  E  N  P  K  A  V |   E  T  F  Q  K  L  Q      p.60

          .         .         .         .         .         .       g.31599
 AAGGCAAAGGAGATTCTGACCAATGAAGAGAGTCGAGCCCGCTATGACCACTGGCGAAGG       c.240
 K  A  K  E  I  L  T  N  E  E  S  R  A  R  Y  D  H  W  R  R         p.80

          .         .         .         .         .        | 04.    g.37395
 AGCCAGATGTCGATGCCATTCCAGCAGTGGGAAGCTTTGAATGACTCAGTGAAGACG | TCA    c.300
 S  Q  M  S  M  P  F  Q  Q  W  E  A  L  N  D  S  V  K  T   | S      p.100

          .         .         .         .         .         .       g.37455
 ATGCACTGGGTTGTCAGAGGTAAAAAAGACCTGATGCTGGAAGAATCTGACAAGACTCAT       c.360
 M  H  W  V  V  R  G  K  K  D  L  M  L  E  E  S  D  K  T  H         p.120

          .         .         .         .         .         .       g.37515
 ACCACCAAGATGGAAAATGAGGAATGTAATGAGCAAAGAGAAAGAAAGAAAGAGGAGCTG       c.420
 T  T  K  M  E  N  E  E  C  N  E  Q  R  E  R  K  K  E  E  L         p.140

          .         .         .         .         .         .       g.37575
 GCTTCAACCGCAGAGAAAACGGAGCAGAAAGAACCCAAGCCCCTAGAGAAGTCAGTCTCC       c.480
 A  S  T  A  E  K  T  E  Q  K  E  P  K  P  L  E  K  S  V  S         p.160

          .         .   | 05     .         .         .         .    g.46007
 CCGCAAAATTCAGATTCTTCAG | GTTTTGCAGATGTGAATGGTTGGCACCTTCGTTTCCGC    c.540
 P  Q  N  S  D  S  S  G |   F  A  D  V  N  G  W  H  L  R  F  R      p.180

          .         .         .         .         .                 g.46064
 TGGTCCAAGGATGCTCCCTCAGAACTCCTGAGGAAGTTCAGAAACTATGAAATATGA          c.597
 W  S  K  D  A  P  S  E  L  L  R  K  F  R  N  Y  E  I  X            p.198

          .         .         .         .         .         .       g.46124
 aatatctctgcttcaaaaaatgaggaagagcaagactgtcccctatgctgccaacatgca       c.*60

          .         .         .         .         .         .       g.46184
 gtctttgtttatgtcttaaaaatgtcatgtttatgtcatgtctgtgaattgctgagtact       c.*120

          .         .         .         .         .         .       g.46244
 aattgattcctccatccttgaatcagttctcataatgctttttaaataagaaaaattcag       c.*180

          .         .         .         .         .         .       g.46304
 aagatgaatttcttccaatatttgaataaattaaagctcttagatacagagtagattgta       c.*240

          .         .         .         .         .         .       g.46364
 ttatatgctttttcctattaatactacttatagaaatccattaaaaagcaatctctgtac       c.*300

          .         .         .         .         .         .       g.46424
 agtgtatttaaatatttcattgacatactgtgatctctattagtgatggatgtacaaaaa       c.*360

          .         .         .         .         .         .       g.46484
 atgttttcttacccttgacttacaatgaaatgtgaaattacttgtctgaaccccgtgggg       c.*420

          .         .                                               g.46511
 agaaataaataattttcccaaagttca                                        c.*447

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The DnaJ (Hsp40) homolog, subfamily C, member 12 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.