DnaJ (Hsp40) homolog, subfamily C, member 19 (DNAJC19) - coding DNA reference sequence

(used for variant description)

(last modified September 25, 2024)

This file was created to facilitate the description of sequence variants on transcript NM_145261.3 in the DNAJC19 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000003.11, covering DNAJC19 transcript NM_145261.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5052
         acgacagttttccggcctagtttgcggctgctcctgccgtgttgcgtagggc       c.-121

 .         .         .         .         .         .                g.5112
 gcctgtgcttgaggttgggggttgcgtcgctctctggtaaaggcgtgcaggtgttggccg       c.-61

 .         .         .         .         .         .                g.5172
 cggcctctgagctgggatgagccgtgctcccggtggaagcaagggagcccagccggagcc       c.-1

     | 02    .         .         .         .         .      | 03  . g.6683
 ATG | GCCAGTACAGTGGTAGCAGTTGGACTGACCATTGCTGCTGCAGGATTTGCAG | GCCGT c.60
 M   | A  S  T  V  V  A  V  G  L  T  I  A  A  A  G  F  A  G |   R   p.20

          .         .         .         .         .         .       g.6743
 TACGTTTTGCAAGCCATGAAGCATATGGAGCCTCAAGTAAAACAAGTTTTTCAAAGCCTA       c.120
 Y  V  L  Q  A  M  K  H  M  E  P  Q  V  K  Q  V  F  Q  S  L         p.40

           | 04        .         .         .         .         .    g.7803
 CCAAAATCT | GCCTTCAGTGGTGGCTATTATAGAGGTGGGTTTGAACCCAAAATGACAAAA    c.180
 P  K  S   | A  F  S  G  G  Y  Y  R  G  G  F  E  P  K  M  T  K      p.60

          .         .          | 05        .         .         .    g.8809
 CGGGAAGCAGCATTAATACTAGGTGTAAG | CCCTACTGCCAATAAAGGGAAAATAAGAGAT    c.240
 R  E  A  A  L  I  L  G  V  S  |  P  T  A  N  K  G  K  I  R  D      p.80

          .         .         .         . | 06       .         .    g.10084
 GCTCATCGACGAATTATGCTTTTAAATCATCCTGACAAAG | GAGGATCTCCTTATATAGCA    c.300
 A  H  R  R  I  M  L  L  N  H  P  D  K  G |   G  S  P  Y  I  A      p.100

          .         .         .         .         .                 g.10135
 GCCAAAATCAATGAAGCTAAAGATTTACTAGAAGGTCAAGCTAAAAAATGA                c.351
 A  K  I  N  E  A  K  D  L  L  E  G  Q  A  K  K  X                  p.116

          .         .         .         .         .         .       g.10195
 agtaaatgtatgatgaattttaagttcgtattagtttatgtatatgagtactaagttttt       c.*60

          .         .         .         .         .         .       g.10255
 ataataaaatgcctcagagctacaattttaaaaaatgatttagcacaagctaaatctcaa       c.*120

          .         .         .         .         .         .       g.10315
 agccttggtataattttcttgtttaaatttggggattttaaatcagattatagtttagaa       c.*180

          .         .         .         .         .         .       g.10375
 tatttgcgtattaattatgggcaagcacacaccttctgaatagaaatattgttcattact       c.*240

          .         .         .         .         .         .       g.10435
 catttagcagataatttgggacctatgtctacttttcaaggcaaagtgaagatgacagtc       c.*300

          .         .         .         .         .         .       g.10495
 cttgctctcagggagcccccactttaatgggagactgataaactggtaattagactgtga       c.*360

          .         .         .         .         .         .       g.10555
 taaatagtatgatggaaattagcttaagctgtttaagtagggactcttcttattcggtgg       c.*420

          .         .         .         .         .         .       g.10615
 aaaggctgttccaggtacaggcaactggcctggcaacttggatacttggaaccttgtatt       c.*480

          .         .         .         .         .         .       g.10675
 taaaagtgaatttaaccacaactgagacctaagaaattgacctaggggtgtgtgtgtgtg       c.*540

          .         .         .         .         .         .       g.10735
 tgtattctatgtacatataaaccatttttatttcatgcattaaaaatagtatgataaaga       c.*600

          .         .         .         .         .         .       g.10795
 tttcagagtacaggtctggtacaatcacagttcattgcagcctcaacctcctgggtttaa       c.*660

          .         .         .         .         .         .       g.10855
 gcagtcctcccgcctcagcctcccaaagtactgggattacaggcatgagtatttacattg       c.*720

          .         .         .         .         .         .       g.10915
 tattcagctagccccttaaaggtaatgaccatttataaattattccttcagttggctatt       c.*780

          .         .         .         .         .         .       g.10975
 tcttgacataatcaaacttctgcaattgttatgattaagcttaaaccctgttagcaaaac       c.*840

          .         .         .         .         .         .       g.11035
 tgaaaactgaaatgttctcaatatcaacatatttaatttggactctttagaatttataca       c.*900

          .         .         .                                     g.11066
 ctaataaatttaaatgatgtttaaaggcaaa                                    c.*931

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The DnaJ (Hsp40) homolog, subfamily C, member 19 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.