DnaJ (Hsp40) homolog, subfamily C, member 30 (DNAJC30) - coding DNA reference sequence

(used for variant description)

(last modified June 23, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_032317.2 in the DNAJC30 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering DNAJC30 transcript NM_032317.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 cttgcaccgcctgccgaatcaattcaac       c.-1

          .         .         .         .         .         .       g.5088
 ATGGCAGCCATGCGCTGGCGATGGTGGCAGCGGCTGTTACCTTGGAGGTTGCTGCAGGCC       c.60
 M  A  A  M  R  W  R  W  W  Q  R  L  L  P  W  R  L  L  Q  A         p.20

          .         .         .         .         .         .       g.5148
 CGTGGCTTTCCACAAAATTCTGCACCCAGCCTGGGCCTAGGAGCGAGGACTTATTCCCAG       c.120
 R  G  F  P  Q  N  S  A  P  S  L  G  L  G  A  R  T  Y  S  Q         p.40

          .         .         .         .         .         .       g.5208
 GGCGACTGCTCGTATTCGCGCACGGCGCTGTATGATCTGCTCGGCGTCCCCTCCACAGCC       c.180
 G  D  C  S  Y  S  R  T  A  L  Y  D  L  L  G  V  P  S  T  A         p.60

          .         .         .         .         .         .       g.5268
 ACGCAGGCCCAAATCAAGGCGGCTTACTACCGTCAGTGCTTTCTCTACCACCCGGACCGC       c.240
 T  Q  A  Q  I  K  A  A  Y  Y  R  Q  C  F  L  Y  H  P  D  R         p.80

          .         .         .         .         .         .       g.5328
 AACTCCGGGAGCGCGGAGGCCGCCGAGCGCTTCACGCGCATCTCCCAGGCCTACGTGGTG       c.300
 N  S  G  S  A  E  A  A  E  R  F  T  R  I  S  Q  A  Y  V  V         p.100

          .         .         .         .         .         .       g.5388
 CTGGGCAGTGCCACCCTCCGTCGCAAGTATGATCGCGGCCTACTCAGCGACGAGGACCTG       c.360
 L  G  S  A  T  L  R  R  K  Y  D  R  G  L  L  S  D  E  D  L         p.120

          .         .         .         .         .         .       g.5448
 CGCGGACCTGGCGTCCGGCCCTCCAGGACGCCCGCACCCGACCCCGGCTCGCCGCGTACC       c.420
 R  G  P  G  V  R  P  S  R  T  P  A  P  D  P  G  S  P  R  T         p.140

          .         .         .         .         .         .       g.5508
 CCGCCGCCCACCTCTCGGACCCACGACGGTTCTCGGGCCTCCCCCGGCGCCAACCGCACG       c.480
 P  P  P  T  S  R  T  H  D  G  S  R  A  S  P  G  A  N  R  T         p.160

          .         .         .         .         .         .       g.5568
 ATGTTCAACTTTGACGCCTTCTACCAGGCCCACTACGGGGAACAACTGGAGCGGGAACGG       c.540
 M  F  N  F  D  A  F  Y  Q  A  H  Y  G  E  Q  L  E  R  E  R         p.180

          .         .         .         .         .         .       g.5628
 CGCCTGAGGGCCCGGCGGGAGGCCCTTCGCAAACGGCAGGAGTATCGGTCCATGAAAGGC       c.600
 R  L  R  A  R  R  E  A  L  R  K  R  Q  E  Y  R  S  M  K  G         p.200

          .         .         .         .         .         .       g.5688
 CTCCGCTGGGAGGATACCCGAGACACGGCTGCCATTTTCCTCATCTTTTCAATCTTCATC       c.660
 L  R  W  E  D  T  R  D  T  A  A  I  F  L  I  F  S  I  F  I         p.220

          .         .                                               g.5709
 ATCATCGGCTTTTATATTTAA                                              c.681
 I  I  G  F  Y  I  X                                                p.226

          .         .         .         .         .         .       g.5769
 tcggagagagaagggaaggggagtgtccccagccaaccccccagaaacggccttttttcc       c.*60

          .         .         .         .         .         .       g.5829
 tgcctctgaacccttggccattgatagtctacctttgctgggatccgaaggaactgtact       c.*120

          .         .         .         .         .         .       g.5889
 ccccctgccctccccgacccgcccagcttagccgatgacctgcacatcgctccactgtgg       c.*180

          .         .         .         .         .         .       g.5949
 tccagaaaaggaggcctttcgatgtctgagaaagaggccccacgctgtagagtcccgaaa       c.*240

          .         .         .         .         .         .       g.6009
 gcccaggagtgaagggggttcctggagtctctagggtgcttcttccagagtctgtcttct       c.*300

          .         .         .         .         .         .       g.6069
 tgcttccagatgtggtcaacttctggaacactcgctgtagctttattgtttagccccaag       c.*360

          .         .         .         .         .         .       g.6129
 caagatttatctcctcctgccccgcatgtgtatggtgggcctctgtaaccttgaaatgtg       c.*420

          .         .         .         .         .         .       g.6189
 caatgtgaccaattgttgactaccaaaagaaaaggtctggggttgtacgaaacttgtctt       c.*480

          .         .         .         .         .         .       g.6249
 tctgtgacttccccaagccgcaggtgagacctggtccagggtaagaatgggatcggtgga       c.*540

          .         .         .         .         .         .       g.6309
 gagcctgtcgttcctcccgctaaggtcagccccctggggcactcctccttatgttgatag       c.*600

          .         .         .         .         .         .       g.6369
 catgtaggagtgagaaaaagtcattgagcataaggaatgagtgttcctgtgcccatattt       c.*660

          .         .         .         .         .         .       g.6429
 aatgtgtgaccttggagaagttactctgtaggcatgacagcagaggagaaaatcatttgg       c.*720

          .         .         .         .         .         .       g.6489
 catcttgaggtctgtcatgctttattatccatagtttttggggggttttttgttttgttt       c.*780

          .         .         .         .         .         .       g.6549
 tgtttttgagatggagtcttgcgctctgttgcccaggctggagtgcagtggtgcgatctt       c.*840

          .         .         .         .         .         .       g.6609
 agctcactgcaacctccacctcccgggttcaagcgattctcctgcctcagcctcctgtgt       c.*900

          .         .         .         .         .         .       g.6669
 aactgggattacaggctcccaccacacctggctagtgttttgtatttttagtagatacgg       c.*960

          .         .         .         .         .         .       g.6729
 ggtttcaccatgctggccagactgaggtctcgaactgccgacctcaggctgtctgcccgt       c.*1020

          .         .         .         .         .         .       g.6789
 ccagcctcccaaagtgctgggattgcaggcatgagccactgctcccggccctattatcca       c.*1080

          .         .         .         .         .         .       g.6849
 tagttctaatccacagggattacagcataatgctagcagggccaggttcatccttgagac       c.*1140

          .         .         .         .         .         .       g.6909
 agtgtggctggctgtcacctggtcctccctttaccagccagccccattgcacactgtgca       c.*1200

          .         .         .         .         .         .       g.6969
 gcccatcccctcccagaaatagagtgacaaactctgcacttaagtcccctgtttctgttt       c.*1260

          .         .         .         .         .         .       g.7029
 aacttgcagtgcttatcacaggcccttccttaattttttaaacaaggctgcttgaggctg       c.*1320

          .         .         .         .         .         .       g.7089
 gggtaaattttggggctttgggagtacacaggactactgagggacggggagttggtggct       c.*1380

          .         .         .         .         .         .       g.7149
 tggtgttcatggtggagacttggttctttacgcagagcaggctaaaggcgtgttttttct       c.*1440

          .         .         .         .         .         .       g.7209
 gctctgtttctaattcatgttaagtagttggtcatcactttggtcagagctgctgctgaa       c.*1500

          .         .         .         .         .         .       g.7269
 gctctcttaactgtgagtcactggacgttggcagggagttggctgtgagattgtaggtgc       c.*1560

          .         .         .         .         .         .       g.7329
 tcaagtgtttctgttcgggactgagtgtgaatctgtaaaaggggaaaatcctcgcaagag       c.*1620

          .         .         .         .         .         .       g.7389
 gtctacgagaaggatgagggcccaagtctagggtctaaacaaagccaggagtggtttggt       c.*1680

          .         .         .         .         .         .       g.7449
 atattactgagtgcaatcattgcgtgccattcctgcactcaatgtattgtgtaaaatcct       c.*1740

          .         .         .         .         .         .       g.7509
 taggtaaaatgggataaacccacagctggtcctacttggcctcttgaaaaccattccatc       c.*1800

          .         .                                               g.7534
 attgtgccaatctagcctgaaaagg                                          c.*1825

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The DnaJ (Hsp40) homolog, subfamily C, member 30 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.