dynamin 1-like (DNM1L) - coding DNA reference sequence

(used for variant description)

(last modified February 23, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_001278464.1 in the DNM1L gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012219.1, covering DNM1L transcript NM_001278464.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5041
                 agcgcatggcctgccgggagggggcaggtagccggcgggcccgg       c.-121

 .         .         .         .         .         .                g.5101
 tccaatgggtgccggcttccgaggagagggcggaggagaggaggaaggaggcgaactgtg       c.-61

 .         .         .         .         .         .                g.5161
 ggccccggccccattcattgccgtggccggcgggcactggggccccgtgttttcagagtc       c.-1

          .         .         .         .         .         .       g.5221
 ATGGAGGCGCTAATTCCTGTCATAAACAAGCTCCAGGACGTCTTCAACACGGTGGGCGCC       c.60
 M  E  A  L  I  P  V  I  N  K  L  Q  D  V  F  N  T  V  G  A         p.20

          .         .         .         .   | 02     .         .    g.27230
 GACATCATCCAGCTGCCTCAAATCGTCGTAGTGGGAACGCAG | AGCAGCGGAAAGAGCTCA    c.120
 D  I  I  Q  L  P  Q  I  V  V  V  G  T  Q   | S  S  G  K  S  S      p.40

          .         .         .         .         .         .       g.27290
 GTGCTAGAAAGCCTGGTGGGGAGGGACCTGCTTCCCAGAGGTACTGGAATTGTCACCCGG       c.180
 V  L  E  S  L  V  G  R  D  L  L  P  R  G  T  G  I  V  T  R         p.60

          .         .         .         .         .         .       g.27350
 AGACCTCTCATTCTGCAACTGGTCCATGTTTCACAAGAAGATAAACGGAAAACAACAGGA       c.240
 R  P  L  I  L  Q  L  V  H  V  S  Q  E  D  K  R  K  T  T  G         p.80

          . | 03       .         .         .          | 04        . g.33175
 GAAGAAAATG | ACCCTGCTACATGGAAAAACTCAAGACACCTTTCTAAAG | GGGTGGAAGCA c.300
 E  E  N  D |   P  A  T  W  K  N  S  R  H  L  S  K  G |   V  E  A   p.100

          .         .         .       | 05 .         .         .    g.33974
 GAAGAATGGGGTAAATTTCTTCACACCAAAAATAAG | CTTTACACGGATTTTGATGAAATT    c.360
 E  E  W  G  K  F  L  H  T  K  N  K   | L  Y  T  D  F  D  E  I      p.120

          .         .         .         .         | 06         .    g.36738
 CGACAAGAAATTGAAAATGAAACAGAAAGAATTTCAGGAAATAATAAG | GGAGTAAGCCCT    c.420
 R  Q  E  I  E  N  E  T  E  R  I  S  G  N  N  K   | G  V  S  P      p.140

          .         .         .         .         .         .       g.36798
 GAACCAATTCATCTTAAGATTTTTTCACCCAACGTTGTCAATTTGACACTTGTGGATTTG       c.480
 E  P  I  H  L  K  I  F  S  P  N  V  V  N  L  T  L  V  D  L         p.160

          .      | 07  .         .         .         .         .    g.39051
 CCAGGAATGACCAAG | GTGCCTGTAGGTGATCAACCTAAGGATATTGAGCTTCAAATCAGA    c.540
 P  G  M  T  K   | V  P  V  G  D  Q  P  K  D  I  E  L  Q  I  R      p.180

          .         .         .         .         .         .       g.39111
 GAGCTCATTCTTCGGTTCATCAGTAATCCTAATTCCATTATCCTCGCTGTCACTGCTGCT       c.600
 E  L  I  L  R  F  I  S  N  P  N  S  I  I  L  A  V  T  A  A         p.200

          .         .         .         .         .         | 08    g.44442
 AATACAGATATGGCAACATCAGAGGCACTTAAAATTTCAAGAGAGGTAGATCCAGATG | GT    c.660
 N  T  D  M  A  T  S  E  A  L  K  I  S  R  E  V  D  P  D  G |       p.220

          .         .         .         .         .         .       g.44502
 CGCAGAACCCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATG       c.720
 R  R  T  L  A  V  I  T  K  L  D  L  M  D  A  G  T  D  A  M         p.240

          .         .         .         .         .          | 09    g.46462
 GATGTATTGATGGGAAGGGTTATTCCAGTCAAACTTGGAATAATTGGAGTAGTTAACAG | G    c.780
 D  V  L  M  G  R  V  I  P  V  K  L  G  I  I  G  V  V  N  R  |      p.260

          .         .         .         .         .         .       g.46522
 AGCCAGCTAGATATTAACAACAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCT       c.840
 S  Q  L  D  I  N  N  K  K  S  V  T  D  S  I  R  D  E  Y  A         p.280

          .         .         .         .         .         .       g.46582
 TTTCTTCAAAAGAAATATCCATCTCTGGCCAATAGAAATGGAACAAAGTATCTTGCTAGG       c.900
 F  L  Q  K  K  Y  P  S  L  A  N  R  N  G  T  K  Y  L  A  R         p.300

          .  | 10      .         .         .         .         .    g.48273
 ACTCTAAACAG | GTTACTGATGCATCACATCAGAGATTGTTTACCAGAGTTGAAAACAAGA    c.960
 T  L  N  R  |  L  L  M  H  H  I  R  D  C  L  P  E  L  K  T  R      p.320

          .         .         .         .         .         .       g.48333
 ATAAATGTTCTAGCTGCTCAGTATCAGTCTCTTCTAAATAGCTACGGTGAACCCGTGGAT       c.1020
 I  N  V  L  A  A  Q  Y  Q  S  L  L  N  S  Y  G  E  P  V  D         p.340

          .         .         .         .         .         .       g.48393
 GATAAAAGTGCTACTTTACTCCAACTTATTACCAAATTTGCCACAGAATATTGTAACACT       c.1080
 D  K  S  A  T  L  L  Q  L  I  T  K  F  A  T  E  Y  C  N  T         p.360

          .         .         .         | 11         .         .    g.56833
 ATTGAAGGAACTGCAAAATATATTGAAACTTCGGAGCT | ATGCGGTGGTGCTAGAATTTGT    c.1140
 I  E  G  T  A  K  Y  I  E  T  S  E  L  |  C  G  G  A  R  I  C      p.380

          .         .         .         .         .         .       g.56893
 TATATTTTCCATGAGACTTTTGGGCGAACCTTAGAATCTGTTGATCCACTTGGTGGCCTT       c.1200
 Y  I  F  H  E  T  F  G  R  T  L  E  S  V  D  P  L  G  G  L         p.400

          .         .         .          | 12        .         .    g.57174
 AACACTATTGACATTTTGACTGCCATTAGAAATGCTACT | GGTCCTCGTCCTGCTTTATTT    c.1260
 N  T  I  D  I  L  T  A  I  R  N  A  T   | G  P  R  P  A  L  F      p.420

          .         .         .         .         .         .       g.57234
 GTGCCTGAGGTTTCATTTGAGTTACTGGTGAAGCGGCAAATCAAACGTCTAGAAGAGCCC       c.1320
 V  P  E  V  S  F  E  L  L  V  K  R  Q  I  K  R  L  E  E  P         p.440

          .         .         .         .         .         .       g.57294
 AGCCTCCGCTGTGTGGAACTGGTTCATGAGGAAATGCAAAGGATCATTCAGCACTGTAGC       c.1380
 S  L  R  C  V  E  L  V  H  E  E  M  Q  R  I  I  Q  H  C  S         p.460

          .      | 13  .         .         .         .         .    g.57696
 AATTACAGTACACAG | GAATTGTTACGATTTCCTAAACTTCATGATGCCATAGTTGAAGTG    c.1440
 N  Y  S  T  Q   | E  L  L  R  F  P  K  L  H  D  A  I  V  E  V      p.480

          .         .         .         .      | 14  .         .    g.59527
 GTGACTTGTCTTCTTCGTAAAAGGTTGCCTGTTACAAATGAAATG | GTCCATAACTTAGTG    c.1500
 V  T  C  L  L  R  K  R  L  P  V  T  N  E  M   | V  H  N  L  V      p.500

          .         .         .         .         .         .       g.59587
 GCAATTGAACTGGCTTATATCAACACAAAACATCCAGACTTTGCTGATGCTTGTGGGCTA       c.1560
 A  I  E  L  A  Y  I  N  T  K  H  P  D  F  A  D  A  C  G  L         p.520

          .         | 15         .         .         .         .    g.62944
 ATGAACAATAATATAGAG | GAACAAAGGAGAAACAGGCTAGCCAGAGAATTACCTTCAGCT    c.1620
 M  N  N  N  I  E   | E  Q  R  R  N  R  L  A  R  E  L  P  S  A      p.540

          .      | 16  .         .         .         .         .    g.63707
 GTATCACGAGACAAG | TCTTCTAAAGTTCCAAGTGCTTTGGCACCTGCCTCCCAGGAGCCC    c.1680
 V  S  R  D  K   | S  S  K  V  P  S  A  L  A  P  A  S  Q  E  P      p.560

          .         .         .    | 17    .         .         .    g.64088
 TCCCCCGCTGCTTCTGCTGAGGCTGATGGCAAG | TTAATTCAGGACAGCAGAAGAGAAACT    c.1740
 S  P  A  A  S  A  E  A  D  G  K   | L  I  Q  D  S  R  R  E  T      p.580

        | 18 .         .         .         .         .         .    g.65915
 AAAAAT | GTTGCATCTGGAGGTGGTGGGGTTGGAGATGGTGTTCAAGAACCAACCACAGGC    c.1800
 K  N   | V  A  S  G  G  G  G  V  G  D  G  V  Q  E  P  T  T  G      p.600

          .         .         .         .         .         .       g.65975
 AACTGGAGAGGAATGCTGAAAACTTCAAAAGCTGAAGAGTTATTAGCAGAAGAAAAATCA       c.1860
 N  W  R  G  M  L  K  T  S  K  A  E  E  L  L  A  E  E  K  S         p.620

          .         .         .         .         .         .       g.66035
 AAACCCATTCCAATTATGCCAGCCAGTCCACAAAAAGGTCATGCCGTGAACCTGCTAGAT       c.1920
 K  P  I  P  I  M  P  A  S  P  Q  K  G  H  A  V  N  L  L  D         p.640

     | 19    .         .         .         .         .         .    g.66263
 GTG | CCAGTTCCTGTTGCACGAAAACTATCTGCTCGGGAACAGCGAGATTGTGAGGTTATT    c.1980
 V   | P  V  P  V  A  R  K  L  S  A  R  E  Q  R  D  C  E  V  I      p.660

          .         .         .         .         .    | 20    .    g.68393
 GAACGACTCATTAAATCATATTTTCTCATTGTCAGAAAGAATATTCAAGACAG | TGTGCCA    c.2040
 E  R  L  I  K  S  Y  F  L  I  V  R  K  N  I  Q  D  S  |  V  P      p.680

          .         .         .         .         .         .       g.68453
 AAGGCAGTAATGCATTTTTTGGTTAATCATGTGAAAGACACTCTTCAGAGTGAGCTAGTA       c.2100
 K  A  V  M  H  F  L  V  N  H  V  K  D  T  L  Q  S  E  L  V         p.700

          .         .         .         .         .         .       g.68513
 GGCCAGCTGTATAAATCATCCTTATTGGATGATCTTCTGACAGAATCTGAGGACATGGCA       c.2160
 G  Q  L  Y  K  S  S  L  L  D  D  L  L  T  E  S  E  D  M  A         p.720

          .         .         .    | 21    .         .         .    g.69178
 CAGCGCAGGAAAGAAGCAGCTGATATGCTAAAG | GCATTACAAGGAGCCAGTCAAATTATT    c.2220
 Q  R  R  K  E  A  A  D  M  L  K   | A  L  Q  G  A  S  Q  I  I      p.740

          .         .         .                                     g.69208
 GCTGAAATCCGGGAGACTCATCTTTGGTGA                                     c.2250
 A  E  I  R  E  T  H  L  W  X                                       p.749

          .         .         .         .         .         .       g.69268
 agagaactatgtaatactgagactttgttgactcaaaacttgctagttactgcctacctg       c.*60

          .         .         .         .         .         .       g.69328
 agtagaatcttatttatgaactcctgtgtattgcaatggtatgaatctgctcatgtggag       c.*120

          .         .         .         .         .         .       g.69388
 actggctataaactgaaaagtgtattccaaattgcagaacacatcacacatttaatccaa       c.*180

          .         .         .         .         .         .       g.69448
 ataataaatggctgtttctaaagtttcccagtatatataaaatacatcaagtctgtcttg       c.*240

          .         .         .         .         .         .       g.69508
 tgacagtttcatctgaacttaacttaaaaacaactgttaatgttctagttgtgcaaagca       c.*300

          .         .         .         .         .         .       g.69568
 gtttgcctgtggataagatgacctgtgtaataatctttgttagtagtcttaaagctgctg       c.*360

          .         .         .         .         .         .       g.69628
 ccatagtcctccaagaagaaagcaccaagacaacatttcatatgactataatgcatgtac       c.*420

          .         .         .         .         .         .       g.69688
 tatataagctgatctggctttgaaagatgtgagttggcaagttcctcacatagagtcatt       c.*480

          .         .         .         .         .         .       g.69748
 gtattccacctgtccttcaatttagttttttctgagcttctttgcagcctttgatgtgtt       c.*540

          .         .         .         .         .         .       g.69808
 tttaagaaagctgaatgcacaagaggatctgtgacactgacatggctgtggtgtgcatac       c.*600

          .         .         .         .         .         .       g.69868
 tgtgtagttacatagcccttccaattctgggtccatttgcactagcaaattaaaatatgc       c.*660

          .         .         .         .         .         .       g.69928
 tttgattcatacttaaacctgaaagcaggaatgcctacattaattcctacattaaaaaca       c.*720

          .         .         .         .         .         .       g.69988
 gccatctacccttgattatctagaaagacttggtaatgatggtcagttccttttagattt       c.*780

          .         .         .         .         .         .       g.70048
 cagaaaatcaaatgatgacctaaatttcccttaatttgcaaatacagtagtaattaaggt       c.*840

          .         .         .         .         .         .       g.70108
 acatctctaaagtggagcacttacaccaggctctaagattcactttgaggtggaacttaa       c.*900

          .         .         .         .         .         .       g.70168
 aaccagtgtactgtatgtatgcattggtaatagctacttttgcttcatagcttcatacca       c.*960

          .         .         .         .         .         .       g.70228
 acaaaatatatttattagaatagtatgaaagtactggaggagctgaaagaaaaacaccca       c.*1020

          .         .         .         .         .         .       g.70288
 aggctgggcgtggtggcacacgcctgtaatcccagcactttgggaggccgaggcaggtgg       c.*1080

          .         .         .         .         .         .       g.70348
 atcacctgaggttgggagttggagaccagcttgaccaacatggagaaaccccgtctctac       c.*1140

          .         .         .         .         .         .       g.70408
 taaaaatacaaaattggccgggcgtggtggcgcatgcctgtaatcccagctactcgggag       c.*1200

          .         .         .         .         .         .       g.70468
 ggtgaggcaggagaattgcttgaccctgggaggtggaggttgtggtgagctaagatcgtg       c.*1260

          .         .         .         .         .         .       g.70528
 ccattgcactccagccttggcaacaagagcgaaactccgtctcaaaaaaaaaaaataaaa       c.*1320

          .         .         .         .         .         .       g.70588
 caacacccagatagatacacatactccttcagacttacagacctaagctgcatttatggg       c.*1380

          .         .         .         .         .         .       g.70648
 gtagtgatgaggtttagaacatatacatattttgttaaaattccccagatgattcttggt       c.*1440

          .         .         .         .         .         .       g.70708
 atgaacgactatattataaattttaagatgtacttagaaatccttaagacatctagcccc       c.*1500

          .         .         .         .         .         .       g.70768
 gtctctaatagacaacacatttatattgcagatattacttttttttcagtttatgaccag       c.*1560

          .         .         .         .         .         .       g.70828
 gtatttatgaaggactattggcagggaaaatatgaatatgttaactttagcttatggcat       c.*1620

          .         .         .         .         .         .       g.70888
 caatttactaaggaacaacaggctcaccaactgatgtcaaacataaaaacccccacatca       c.*1680

          .         .         .         .         .         .       g.70948
 gtctgatacgatatggtactactttgaatctgttactagtaccatcttgacagaggatac       c.*1740

          .         .         .         .         .         .       g.71008
 atgctcccaaaacgtttgttaccacacttaaaaatcactgccatcattaagcatcagttt       c.*1800

          .         .         .         .         .         .       g.71068
 caaaattatagccattcatgatttactttttccagatgactatcattattctagtccttt       c.*1860

          .         .         .         .         .         .       g.71128
 gaatttgtaaggggaaaaaaaacaaaaacaaaaacttacgatgcacttttctccagcaca       c.*1920

          .         .         .         .         .         .       g.71188
 tcagatttcaaattgaaaattaaagacatgctatggtaatgcacttgctagtactacaca       c.*1980

          .         .         .         .         .         .       g.71248
 ctttgtacaacaaaaaacagaggcaagaaacaacggaaagagaaaagccttcctttgttg       c.*2040

          .         .         .         .         .         .       g.71308
 gcccttaaactgagtcaagatctgaaatgtagagatgatctctgacgatacctgtatgtt       c.*2100

          .         .         .         .         .         .       g.71368
 cttattgtgtaaataaaattgctggtatgaaatgacactaaagtttgtcaaaaaatgaat       c.*2160

          .         .         .         .         .         .       g.71428
 tcttaacttttctcccagagaaagggagacaaaaggagctttttaatacctaatctactt       c.*2220

          .         .                                               g.71448
 tggaacataaccgtatagag                                               c.*2240

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Dynamin 1-like protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center