dedicator of cytokinesis 6 (DOCK6) - 486 nt intron 26 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.44818
gtgggctgccttcacttctgcctcctctctttgacctacaacctctcaccttcagtccat  c.3240+60

         .         .         .         .         .         .  g.44878
ctcctatggttccctcatctctgtccctttcacggtggaccactgcctaggtgaactaat  c.3240+120

         .         .         .         .         .         .  g.44938
cccttatgtttgacttttgacttctgacccttcacctctcttgccattctcagcaatttc  c.3240+180

         .         .         .         .         .         .  g.44998
ccagaaggactaacctctgatttctctcccctaaatcctaactcccagcccagtgttcca  c.3240+240

     g.45001
tct  c.3240+243

--------------------- middle of intron ---------------------
                                             g.45002          g.45004
                                             c.3241-243  gct  c.3241-241

.         .         .         .         .         .           g.45064
atttctcagtcctctgacttttgactccgtgccctgttacatcacagatgggttaacgtc  c.3241-181

.         .         .         .         .         .           g.45124
agcccctcacttctggccttgaaacccatgcccactgtcacctccagatgacttaacatc  c.3241-121

.         .         .         .         .         .           g.45184
agtctttcatctgtggctattggcaccatgatttctgtcacctccaagatggctttaatg  c.3241-61

.         .         .         .         .         .           g.45244
gtgacctgccacctctgacccttgaccgctggcatcccccatttttcccccactctgcag  c.3241-1


Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center