dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit (DPM2) - coding DNA reference sequence

(used for variant description)

(last modified March 20, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_003863.3 in the DPM2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032927.1, covering DPM2 transcript NM_003863.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5004
                                                         gtcc       c.-661

 .         .         .         .         .         .                g.5064
 cggtccgaaacgtgtctgggctgctgcgagagacagtcggtgaaggaagggaggggacat       c.-601

 .         .         .         .         .         .                g.5124
 ccgaagggtggcccgggaggccgggcgatggtgaggagggcgcctcctctccaccaaatc       c.-541

 .         .         .         .         .         .                g.5184
 ctccccatccatgcgggctagggacagaccctcccccgcccaccctaggctggaaagtga       c.-481

 .         .         .         .         .         .                g.5244
 acgttctctgcacctctcccacctacagactaagtagggcacccggtttccgtgtcggct       c.-421

 .         .         .         .         .         .                g.5304
 tcaccactgactcggaatgggatctacctttctctgagcctcacttttcccatctgaaaa       c.-361

 .         .         .         .         .         .                g.5364
 atggaacttccgatcccgcactcccatcccactctggccccgggactctgggatacttag       c.-301

 .         .         .         .         .         .                g.5424
 agattggcttttggtggggcggcgacaggactgtggccatgaaggccagggagtctgggt       c.-241

 .         .         .         .         .         .                g.5484
 ccccaactcggtcccattccctagagagattcgggcagcaaccggccccacaatgctctt       c.-181

 .         .         .         .         .         .                g.5544
 gagaactacacttcgccgatatgcaaagaagaggaggcggttcctgctcgtctccgacga       c.-121

 .         .         .         .         .         .                g.5604
 ggtgggcccgagcaggcctggggactacgactcccggcgtgctccgcagtccaaagccgg       c.-61

 .         .         .         .         .         .                g.5664
 aagagcgtggacccggaaccggatgtggcttgcggctcgggtggctgagcgcgcggggaa       c.-1

     | 02    .         .         .         .         .         .    g.6018
 ATG | GCCACGGGGACAGACCAGGTGGTGGGACTCGGCCTCGTCGCCGTTAGCCTGATCATC    c.60
 M   | A  T  G  T  D  Q  V  V  G  L  G  L  V  A  V  S  L  I  I      p.20

          .         .         .    | 03    .         .         .    g.6856
 TTCACCTACTACACCGCCTGGGTGATTCTCTTG | CCATTCATCGACAGTCAGCATGTCATC    c.120
 F  T  Y  Y  T  A  W  V  I  L  L   | P  F  I  D  S  Q  H  V  I      p.40

          .         .         .         .         .         .       g.6916
 CACAAGTATTTCCTGCCCCGAGCCTATGCTGTCGCCATCCCACTGGCTGCAGGCCTCCTG       c.180
 H  K  Y  F  L  P  R  A  Y  A  V  A  I  P  L  A  A  G  L  L         p.60

          .       | 04 .         .         .         .         .    g.7748
 CTGCTCCTGTTTGTGG | GACTGTTCATCTCCTATGTGATGCTGAAGACCAAGAGAGTGACC    c.240
 L  L  L  F  V  G |   L  F  I  S  Y  V  M  L  K  T  K  R  V  T      p.80

          .                                                         g.7763
 AAGAAGGCTCAGTGA                                                    c.255
 K  K  A  Q  X                                                      p.84

          .         .         .         .         .         .       g.7823
 aggtcccgcagggatgaggctgccagccccttctctgcttcccctccagcacagggacca       c.*60

          .         .         .         .         .         .       g.7883
 agtgggggagcctgcagaacctgtccaggcacagtggctcctcaagcctgcctgtcctgc       c.*120

          .         .         .         .         .         .       g.7943
 agagtccccatggcatggagcttacacctgactgactggagccccctccccgactcccac       c.*180

          .         .         .         .         .         .       g.8003
 ttccagaagctaggagggagggatacctggaagactccggtcacctccttcttgctcagg       c.*240

          .         .         .         .         .         .       g.8063
 gcctaaaagatgctggtcctcccaacctcactctcagactccctgccaccttttcccctg       c.*300

          .         .         .         .         .         .       g.8123
 ggttctgccgtcttgcctcacttcccctcctgtcacatgctgacgttggacttagcaggt       c.*360

          .         .         .         .         .         .       g.8183
 tctaaggccacatgtgtgacctctctgacttctcttcctccaccaaggcagctttcctta       c.*420

          .         .         .         .         .         .       g.8243
 ccctgacacagccccagaccccacaaagccttctggacctggaaagcctggggaaggact       c.*480

          .         .         .         .         .         .       g.8303
 gacagaccccaggaccagccctggggctcagggcagccaccccgggccgctgaccgactg       c.*540

          .         .         .         .         .         .       g.8363
 acctctcctcacggaggcccagccccaaagccccagggctggcccgtttgggacagctga       c.*600

          .         .                                               g.8390
 ccaataaacactgatggtgtgtttgtc                                        c.*627

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.