dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3) - coding DNA reference sequence

(used for variant description)

(last modified October 10, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_018973.3 in the DPM3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012871.1, covering DPM3 transcript NM_018973.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5130
                                            ggcccttccaccttttg       c.-61

 .         .         .         .         .         .                g.5190
 tgggcactcaagttcggacctctgggatcggcgattcccctctggccagggctggtttta       c.-1

          .         .         .         .         .         .       g.5250
 ATGCTCTCCGTGGGCGGGCTTCGGTTGAGTTTGGTCCGCTTTTCCTTTCTGCTCCTCAGG       c.60
 M  L  S  V  G  G  L  R  L  S  L  V  R  F  S  F  L  L  L  R         p.20

          .         .         .         .         .         .       g.5310
 GGAGCATTGCTTCCTTCTCTCGCAGTGACCATGACGAAATTAGCGCAGTGGCTTTGGGGA       c.120
 G  A  L  L  P  S  L  A  V  T  M  T  K  L  A  Q  W  L  W  G         p.40

          .         .         .         .         .         .       g.5370
 CTAGCGATCCTGGGCTCCACCTGGGTGGCCCTGACCACGGGAGCCTTGGGCCTGGAGCTG       c.180
 L  A  I  L  G  S  T  W  V  A  L  T  T  G  A  L  G  L  E  L         p.60

          .         .         .         .         .         .       g.5430
 CCCTTGTCCTGCCAGGAAGTCCTGTGGCCACTGCCCGCCTACTTGCTGGTGTCCGCCGGC       c.240
 P  L  S  C  Q  E  V  L  W  P  L  P  A  Y  L  L  V  S  A  G         p.80

          .         .         .         .         .         .       g.5490
 TGCTATGCCCTGGGCACTGTGGGCTATCGTGTGGCCACTTTTCATGACTGCGAGGACGCC       c.300
 C  Y  A  L  G  T  V  G  Y  R  V  A  T  F  H  D  C  E  D  A         p.100

          .         .         .         .         .         .       g.5550
 GCACGCGAGCTGCAGAGCCAGATACAGGAGGCCCGAGCCGACTTAGCCCGCAGGGGGCTG       c.360
 A  R  E  L  Q  S  Q  I  Q  E  A  R  A  D  L  A  R  R  G  L         p.120

                                                                    g.5559
 CGCTTCTGA                                                          c.369
 R  F  X                                                            p.122

          .         .         .         .         .         .       g.5619
 cagcctaaccccattcctgtgcggacagcccttcctcccatttcccattaaagagccagt       c.*60

          .                                                         g.5630
 ttattttctaa                                                        c.*71

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Dolichyl-phosphate mannosyltransferase polypeptide 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.