dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3) - coding DNA reference sequence

(used for variant description)

(last modified January 14, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_153741.1 in the DPM3 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_012871.1, covering DPM3 transcript NM_153741.1. Intron 1 is not spliced in transcript variant-2 (NM_018973.3) and contains an alternative translation initiation site.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .     | 02       g.5280
                          cgcgcggggaaggggagacgtggggtagag | tgacc    c.-1
                                    altrnative splicing  ^   T

          .         .         .         .         .         .       g.5340
 ATGACGAAATTAGCGCAGTGGCTTTGGGGACTAGCGATCCTGGGCTCCACCTGGGTGGCC       c.60
 M  T  K  L  A  Q  W  L  W  G  L  A  I  L  G  S  T  W  V  A         p.20

          .         .         .         .         .         .       g.5400
 CTGACCACGGGAGCCTTGGGCCTGGAGCTGCCCTTGTCCTGCCAGGAAGTCCTGTGGCCA       c.120
 L  T  T  G  A  L  G  L  E  L  P  L  S  C  Q  E  V  L  W  P         p.40

          .         .         .         .         .         .       g.5460
 CTGCCCGCCTACTTGCTGGTGTCCGCCGGCTGCTATGCCCTGGGCACTGTGGGCTATCGT       c.180
 L  P  A  Y  L  L  V  S  A  G  C  Y  A  L  G  T  V  G  Y  R         p.60

          .         .         .         .         .         .       g.5520
 GTGGCCACTTTTCATGACTGCGAGGACGCCGCACGCGAGCTGCAGAGCCAGATACAGGAG       c.240
 V  A  T  F  H  D  C  E  D  A  A  R  E  L  Q  S  Q  I  Q  E         p.80

          .         .         .                                     g.5559
 GCCCGAGCCGACTTAGCCCGCAGGGGGCTGCGCTTCTGA                            c.279
 A  R  A  D  L  A  R  R  G  L  R  F  X                              p.92

          .         .         .         .         .         .       g.5619
 cagcctaaccccattcctgtgcggacagcccttcctcccatttcccattaaagagccagt       c.*60

          .                                                         g.5630
 ttattttctaa                                                        c.*71

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Dolichyl-phosphate mannosyltransferase polypeptide 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.