dynein, cytoplasmic 2, heavy chain 1 (DYNC2H1) - coding DNA reference sequence

(used for variant description)

(last modified May 2, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_001080463.1 in the DYNC2H1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering DYNC2H1 transcript NM_001080463.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5024
                                     gactacccctggcaaccgcgaagc       c.-121

 .         .         .         .         .         .                g.5084
 tctgcggtcccgcggtcgggctacgggtttgagcaaagctcctctcttcccttcacttcc       c.-61

 .         .         .         .         .         .                g.5144
 ctccggactggtttcttcttccttcccccttcccccaacttccctccaccccttccaatc       c.-1

          .         .         .         .         .         .       g.5204
 ATGGCGAACGGGACTGCGGACGTTCGGAAGCTCTTCATCTTCACTACTACCCAGAATTAC       c.60
 M  A  N  G  T  A  D  V  R  K  L  F  I  F  T  T  T  Q  N  Y         p.20

          .         .         .         .         .         .       g.5264
 TTCGGGTTGATGTCTGAACTCTGGGATCAGCCACTGTTGTGCAACTGTCTTGAAATCAAC       c.120
 F  G  L  M  S  E  L  W  D  Q  P  L  L  C  N  C  L  E  I  N         p.40

          .         .         .         .         .         .       g.5324
 AACTTCTTGGATGACGGCAACCAGATGCTCCTCAGGGTGCAGCGATCCGACGCAGGAATC       c.180
 N  F  L  D  D  G  N  Q  M  L  L  R  V  Q  R  S  D  A  G  I         p.60

          .      | 02  .         .         .         .         .    g.9151
 TCCTTTTCCAACACG | ATTGAGTTTGGTGACACAAAAGATAAAGTGCTGGTGTTTTTCAAG    c.240
 S  F  S  N  T   | I  E  F  G  D  T  K  D  K  V  L  V  F  F  K      p.80

          .         .         .         .         .         .       g.9211
 CTGCGACCTGAAGTAATTACTGATGAGAATCTACATGATAACATTCTTGTTTCATCTATG       c.300
 L  R  P  E  V  I  T  D  E  N  L  H  D  N  I  L  V  S  S  M         p.100

          .         .         .         .         .         .       g.9271
 TTAGAGTCACCTATTAGTTCTCTTTACCAAGCAGTACGGCAAGTATTCGCACCAATGTTG       c.360
 L  E  S  P  I  S  S  L  Y  Q  A  V  R  Q  V  F  A  P  M  L         p.120

        | 03 .         .         .         .         .         .    g.9726
 TTAAAG | GATCAGGAATGGAGCAGAAACTTTGATCCCAAACTTCAGAATCTTTTGAGTGAA    c.420
 L  K   | D  Q  E  W  S  R  N  F  D  P  K  L  Q  N  L  L  S  E      p.140

          .         .         .         .         .         .       g.9786
 CTAGAAGCTGGGTTGGGTATAGTTCTACGAAGATCAGACACTAACTTAACAAAATTGAAA       c.480
 L  E  A  G  L  G  I  V  L  R  R  S  D  T  N  L  T  K  L  K         p.160

          .         .   | 04     .         .         .         .    g.10784
 TTTAAGGAAGATGACACACGAG | GTATCCTTACACCAAGCGATGAGTTCCAGTTTTGGATA    c.540
 F  K  E  D  D  T  R  G |   I  L  T  P  S  D  E  F  Q  F  W  I      p.180

          .         .         .         .         .         .       g.10844
 GAACAAGCTCACCGTGGAAATAAACAGATTAGTAAAGAAAGAGCCAATTATTTTAAAGAA       c.600
 E  Q  A  H  R  G  N  K  Q  I  S  K  E  R  A  N  Y  F  K  E         p.200

          .         .  | 05      .         .         .         .    g.12178
 TTATTTGAAACAATTGCAAGA | GAGTTTTATAACTTGGACAGTCTATCCTTACTAGAAGTT    c.660
 L  F  E  T  I  A  R   | E  F  Y  N  L  D  S  L  S  L  L  E  V      p.220

          .         .         .         .         .         .       g.12238
 GTTGACTTGGTGGAGACTACTCAGGATGTTGTAGATGATGTGTGGAGACAAACAGAACAT       c.720
 V  D  L  V  E  T  T  Q  D  V  V  D  D  V  W  R  Q  T  E  H         p.240

          .         .         .         .       | 06 .         .    g.13214
 GATCATTATCCTGAGTCACGAATGTTGCATCTCTTAGACATCATAG | GTGGTTCATTTGGA    c.780
 D  H  Y  P  E  S  R  M  L  H  L  L  D  I  I  G |   G  S  F  G      p.260

          .         .         .         .         .         .       g.13274
 AGGTTTGTTCAGAAAAAGTTGGGAACTTTGAACCTGTGGGAAGATCCTTATTATCTTGTG       c.840
 R  F  V  Q  K  K  L  G  T  L  N  L  W  E  D  P  Y  Y  L  V         p.280

          .         .         .         .         .         .       g.13334
 AAAGAAAGTCTGAAAGCTGGTATTTCAATTTGTGAACAGTGGGTGATAGTCTGTAATCAT       c.900
 K  E  S  L  K  A  G  I  S  I  C  E  Q  W  V  I  V  C  N  H         p.300

          .         .         .         .         .         .       g.13394
 CTAACAGGTCAGGTGTGGCAGCGCTATGTTCCTCATCCATGGAAAAATGAAAAATATTTT       c.960
 L  T  G  Q  V  W  Q  R  Y  V  P  H  P  W  K  N  E  K  Y  F         p.320

          .         .         .          | 07        .         .    g.16037
 CCAGAAACACTTGACAAACTTGGCAAACGCCTTGAAGAG | GTCTTGGCTATTAGAACAATT    c.1020
 P  E  T  L  D  K  L  G  K  R  L  E  E   | V  L  A  I  R  T  I      p.340

          .         .         .         .         .         .       g.16097
 CATGAGAAGTTTCTCTATTTTCTACCTGCCAGTGAAGAGAAAATCATATGCCTCACTCGA       c.1080
 H  E  K  F  L  Y  F  L  P  A  S  E  E  K  I  I  C  L  T  R         p.360

          .         .         .         .         .     | 08   .    g.16264
 GTATTTGAACCTTTTACTGGCCTGAATCCTGTGCAATATAATCCATATACTGAG | CCCTTG    c.1140
 V  F  E  P  F  T  G  L  N  P  V  Q  Y  N  P  Y  T  E   | P  L      p.380

          .         .         .         .         .         .       g.16324
 TGGAAAGCTGCGGTGTCTCAATATGAAAAGATTATTGCACCTGCGGAACAAAAAATAGCA       c.1200
 W  K  A  A  V  S  Q  Y  E  K  I  I  A  P  A  E  Q  K  I  A         p.400

          .         .         .         .         | 09         .    g.16506
 GGAAAATTGAAAAATTATATTTCAGAAATTCAAGACAGTCCACAGCAG | CTTCTTCAAGCA    c.1260
 G  K  L  K  N  Y  I  S  E  I  Q  D  S  P  Q  Q   | L  L  Q  A      p.420

          .         .         .         .         .         .       g.16566
 TTCCTGAAATATAAAGAGTTGGTAAAGCGTCCAACTATAAGCAAAGAATTGATGTTAGAA       c.1320
 F  L  K  Y  K  E  L  V  K  R  P  T  I  S  K  E  L  M  L  E         p.440

          .         .         .         . | 10       .         .    g.16961
 AGAGAAACTTTACTGGCAAGACTTGTGGACTCAATTAAAG | ATTTTCGATTAGACTTTGAG    c.1380
 R  E  T  L  L  A  R  L  V  D  S  I  K  D |   F  R  L  D  F  E      p.460

          .         .         .         .         .         .       g.17021
 AATCGGTGCCGAGGAATTCCTGGTGATGCATCTGGACCACTTTCTGGCAAAAATCTTTCA       c.1440
 N  R  C  R  G  I  P  G  D  A  S  G  P  L  S  G  K  N  L  S         p.480

          .         .         .         .      | 11  .         .    g.18409
 GAAGTTGTCAACAGTATAGTTTGGGTTCGCCAGTTGGAATTGAAG | GTAGATGATACTATC    c.1500
 E  V  V  N  S  I  V  W  V  R  Q  L  E  L  K   | V  D  D  T  I      p.500

          .         .         .         .         .         .       g.18469
 AAGATTGCAGAGGCTCTTTTATCTGACTTGCCAGGATTTCGATGTTTCCATCAAAGTGCC       c.1560
 K  I  A  E  A  L  L  S  D  L  P  G  F  R  C  F  H  Q  S  A         p.520

          .         .         .         .         .         .       g.18529
 AAAGATCTCTTAGACCAGCTTAAACTATATGAACAGGAACAATTTGATGATTGGTCCAGG       c.1620
 K  D  L  L  D  Q  L  K  L  Y  E  Q  E  Q  F  D  D  W  S  R         p.540

          .         .         .         .  | 12      .         .    g.20688
 GATATTCAATCAGGTTTATCTGATTCCAGATCTGGTTTGTG | TATTGAGGCTAGTAGTCGA    c.1680
 D  I  Q  S  G  L  S  D  S  R  S  G  L  C  |  I  E  A  S  S  R      p.560

          .         .         .         .         .         .       g.20748
 ATTATGGAATTGGATTCTAATGATGGATTACTAAAAGTGCATTATTCAGATCGTTTGGTG       c.1740
 I  M  E  L  D  S  N  D  G  L  L  K  V  H  Y  S  D  R  L  V         p.580

          .         .         .         .         .         .       g.20808
 ATTCTTCTGAGAGAAGTTCGTCAGCTCTCTGCACTTGGCTTTGTTATTCCTGCCAAAATA       c.1800
 I  L  L  R  E  V  R  Q  L  S  A  L  G  F  V  I  P  A  K  I         p.600

          .         .         .         .         .        | 13.    g.24482
 CAGCAAGTTGCAAACATTGCACAGAAATTCTGCAAGCAAGCAATTATTCTTAAACAA | GTG    c.1860
 Q  Q  V  A  N  I  A  Q  K  F  C  K  Q  A  I  I  L  K  Q   | V      p.620

          .         .         .         .         .         .       g.24542
 GCACATTTTTATAATTCTATTGATCAACAAATGATTCAAAGTCAGAGGCCAATGATGTTA       c.1920
 A  H  F  Y  N  S  I  D  Q  Q  M  I  Q  S  Q  R  P  M  M  L         p.640

          .         .         .    | 14    .         .         .    g.29151
 CAATCTGCCTTAGCATTTGAACAGATAATTAAG | AATTCAAAAGCAGGAAGTGGAGGGAAA    c.1980
 Q  S  A  L  A  F  E  Q  I  I  K   | N  S  K  A  G  S  G  G  K      p.660

          .         .         .         .         .         .       g.29211
 TCACAGATAACTTGGGATAATCCTAAAGAATTAGAAGGCTATATCCAAAAACTCCAAAAT       c.2040
 S  Q  I  T  W  D  N  P  K  E  L  E  G  Y  I  Q  K  L  Q  N         p.680

          .         .         .         .         .         .       g.29271
 GCTGCTGAACGGCTTGCCACTGAAAATAGAAAACTGAGAAAATGGCACACTACATTTTGT       c.2100
 A  A  E  R  L  A  T  E  N  R  K  L  R  K  W  H  T  T  F  C         p.700

        | 15 .         .         .         .         .         .    g.29944
 GAAAAG | GTGGTTGTTCTTATGAATATTGATCTGCTTCGGCAGCAACAGCGCTGGAAAGAT    c.2160
 E  K   | V  V  V  L  M  N  I  D  L  L  R  Q  Q  Q  R  W  K  D      p.720

          .         .         .         .      | 16  .         .    g.31079
 GGATTACAAGAATTGAGAACTGGCTTAGCAACTGTAGAAGCACAG | GGATTCCAAGCAAGT    c.2220
 G  L  Q  E  L  R  T  G  L  A  T  V  E  A  Q   | G  F  Q  A  S      p.740

          .         .         .         .         .         .       g.31139
 GACATGCATGCATGGAAACAACACTGGAATCATCAACTGTACAAAGCTCTGGAGCATCAG       c.2280
 D  M  H  A  W  K  Q  H  W  N  H  Q  L  Y  K  A  L  E  H  Q         p.760

          .         .         .         .         .         .       g.31199
 TACCAGATGGGCTTAGAAGCACTTAATGAGAATTTGCCAGAAATAAATATAGACTTAACT       c.2340
 Y  Q  M  G  L  E  A  L  N  E  N  L  P  E  I  N  I  D  L  T         p.780

       | 17  .         .         .         .         .         .    g.31344
 TACAA | ACAGGGACGATTACAATTCAGGCCCCCTTTTGAAGAAATCCGGGCTAAATATTAT    c.2400
 Y  K  |  Q  G  R  L  Q  F  R  P  P  F  E  E  I  R  A  K  Y  Y      p.800

          .         .         .         .         .         .       g.31404
 AGAGAAATGAAGAGATTCATCGGCATTCCAAATCAGTTTAAGGGAGTGGGTGAGGCAGGA       c.2460
 R  E  M  K  R  F  I  G  I  P  N  Q  F  K  G  V  G  E  A  G         p.820

          .         .         .         .         .         .       g.31464
 GATGAATCTATTTTTTCTATTATGATTGATAGAAATGCAAGTGGATTTTTGACGATTTTC       c.2520
 D  E  S  I  F  S  I  M  I  D  R  N  A  S  G  F  L  T  I  F         p.840

          .         .         .         .         .     | 18   .    g.38843
 AGCAAAGCAGAAGATCTGTTTAGAAGATTGTCAGCTGTTTTACACCAACATAAG | GAATGG    c.2580
 S  K  A  E  D  L  F  R  R  L  S  A  V  L  H  Q  H  K   | E  W      p.860

          .         .         .         .         .         .       g.38903
 ATTGTAATTGGGCAAGTTGATATGGAAGCTCTGGTGGAAAAGCATCTTTTTACTGTACAT       c.2640
 I  V  I  G  Q  V  D  M  E  A  L  V  E  K  H  L  F  T  V  H         p.880

          .         .         .         .         .         .       g.38963
 GATTGGGAGAAAAATTTTAAAGCATTAAAAATAAAGGGGAAAGAAGTAGAACGACTTCCA       c.2700
 D  W  E  K  N  F  K  A  L  K  I  K  G  K  E  V  E  R  L  P         p.900

    | 19     .         .         .         .         .         .    g.43399
 AG | TGCTGTCAAGGTAGATTGTTTAAATATTAATTGCAACCCTGTGAAGACTGTGATTGAT    c.2760
 S  |  A  V  K  V  D  C  L  N  I  N  C  N  P  V  K  T  V  I  D      p.920

          .         .         .         .         .         | 20    g.44061
 GATCTCATCCAGAAGTTATTTGATCTGCTTGTTCTTTCTTTGAAGAAGTCCATACAGG | CT    c.2820
 D  L  I  Q  K  L  F  D  L  L  V  L  S  L  K  K  S  I  Q  A |       p.940

          .         .         .         .         .         .       g.44121
 CATTTACATGAAATTGATACATTTGTTACTGAGGCTATGGAAGTCTTAACAATTATGCCC       c.2880
 H  L  H  E  I  D  T  F  V  T  E  A  M  E  V  L  T  I  M  P         p.960

          .         .         .         .         .         .       g.44181
 CAGTCTGTGGAAGAAATTGGTGATGCAAATCTACAATATAGTAAGTTACAAGAACGGAAG       c.2940
 Q  S  V  E  E  I  G  D  A  N  L  Q  Y  S  K  L  Q  E  R  K         p.980

        | 21 .         .         .         .         .         .    g.47759
 CCAGAG | ATTTTGCCCTTATTTCAAGAAGCTGAAGACAAAAACAGACTTTTACGAACTGTG    c.3000
 P  E   | I  L  P  L  F  Q  E  A  E  D  K  N  R  L  L  R  T  V      p.1000

          .         .         .         .         .         .       g.47819
 GCTGGTGGAGGTTTAGAAACAATTAGTAATTTGAAAGCCAAGTGGGATAAATTTGAGTTA       c.3060
 A  G  G  G  L  E  T  I  S  N  L  K  A  K  W  D  K  F  E  L         p.1020

          .         .         .       | 22 .         .         .    g.48896
 ATGATGGAAAGTCACCAACTTATGATTAAAGACCAG | ATTGAAGTGATGAAAGGAAATGTG    c.3120
 M  M  E  S  H  Q  L  M  I  K  D  Q   | I  E  V  M  K  G  N  V      p.1040

          .         .         .         .         .         .       g.48956
 AAATCACGTCTTCAGATCTATTATCAAGAACTGGAAAAATTTAAAGCTCGTTGGGACCAA       c.3180
 K  S  R  L  Q  I  Y  Y  Q  E  L  E  K  F  K  A  R  W  D  Q         p.1060

          .         .         .         .         .         .       g.49016
 CTAAAGCCTGGTGATGATGTTATTGAAACTGGCCAACATAATACTCTTGATAAAAGTGCA       c.3240
 L  K  P  G  D  D  V  I  E  T  G  Q  H  N  T  L  D  K  S  A         p.1080

          .         .         .         .         .         .       g.49076
 AAGTTAATAAAAGAGAAAAAAATTGAGTTTGATGATCTTGAAGTCACAAGAAAAAAGCTG       c.3300
 K  L  I  K  E  K  K  I  E  F  D  D  L  E  V  T  R  K  K  L         p.1100

    | 23     .         .         .         .         .         .    g.50078
 GT | TGATGATTGCCATCATTTTAGACTGGAAGAGCCTAATTTCTCCCTGGCAAGTAGTATC    c.3360
 V  |  D  D  C  H  H  F  R  L  E  E  P  N  F  S  L  A  S  S  I      p.1120

          .         .         .         .         .         .       g.50138
 TCTAAAGATATCGAGAGCTGTGCCCAAATTTGGGCCTTTTATGAAGAGTTTCAACAAGGA       c.3420
 S  K  D  I  E  S  C  A  Q  I  W  A  F  Y  E  E  F  Q  Q  G         p.1140

          .         .         .         | 24         .         .    g.50286
 TTTCAGGAAATGGCCAATGAAGACTGGATCACTTTTCG | GACTAAGACATACCTGTTTGAG    c.3480
 F  Q  E  M  A  N  E  D  W  I  T  F  R  |  T  K  T  Y  L  F  E      p.1160

          .         .         .         .         .         .       g.50346
 GAATTTTTGATGAACTGGCATGACAGATTAAGGAAGGTTGAAGAACATTCAGTGATGACA       c.3540
 E  F  L  M  N  W  H  D  R  L  R  K  V  E  E  H  S  V  M  T         p.1180

          .         .         .    | 25    .         .         .    g.50927
 GTGAAATTACAATCAGAGGTTGACAAATATAAA | ATCGTAATTCCTATCTTGAAATATGTG    c.3600
 V  K  L  Q  S  E  V  D  K  Y  K   | I  V  I  P  I  L  K  Y  V      p.1200

          .         .         .         .         .         .       g.50987
 AGAGGGGAGCATCTTTCTCCAGATCACTGGCTTGACCTTTTTCGTCTCCTTGGACTTCCT       c.3660
 R  G  E  H  L  S  P  D  H  W  L  D  L  F  R  L  L  G  L  P         p.1220

          .         .         .         .         .         .       g.51047
 AGGGGGACTAGTCTAGAGAAACTACTGTTTGGTGATTTGCTCAGAGTAGCTGATACAATT       c.3720
 R  G  T  S  L  E  K  L  L  F  G  D  L  L  R  V  A  D  T  I         p.1240

          .         .     | 26   .         .         .         .    g.51993
 GTAGCCAAAGCTGCCGACCTTAAA | GATTTAAATAGTCGGGCACAAGGTGAAGTTACAATC    c.3780
 V  A  K  A  A  D  L  K   | D  L  N  S  R  A  Q  G  E  V  T  I      p.1260

          .         .         .         .         .         .       g.52053
 AGAGAAGCTTTACGTGAACTTGATCTTTGGGGAGTTGGAGCAGTGTTTACATTAATTGAT       c.3840
 R  E  A  L  R  E  L  D  L  W  G  V  G  A  V  F  T  L  I  D         p.1280

          .         .         .         .         .         .       g.52113
 TATGAAGACAGCCAAAGTCGAACTATGAAGCTGATTAAAGACTGGAAAGATATAGTAAAT       c.3900
 Y  E  D  S  Q  S  R  T  M  K  L  I  K  D  W  K  D  I  V  N         p.1300

          .         .         .         .         .         .       g.52173
 CAGGTTGGAGATAATAGATGCCTTCTCCAATCCTTAAAGGATTCTCCTTATTATAAAGGA       c.3960
 Q  V  G  D  N  R  C  L  L  Q  S  L  K  D  S  P  Y  Y  K  G         p.1320

          .         .         .         .         .         .       g.52233
 TTTGAAGATAAAGTATCAATTTGGGAAAGAAAACTTGCAGAGTTAGATGAATACCTGCAG       c.4020
 F  E  D  K  V  S  I  W  E  R  K  L  A  E  L  D  E  Y  L  Q         p.1340

          .         .         .         .         .         .       g.52293
 AATTTAAATCATATTCAGAGAAAGTGGGTGTATTTGGAACCCATTTTCGGCCGTGGAGCA       c.4080
 N  L  N  H  I  Q  R  K  W  V  Y  L  E  P  I  F  G  R  G  A         p.1360

          .         .         .         .        | 27.         .    g.54259
 TTGCCAAAAGAACAGACACGCTTCAACAGAGTTGATGAAGATTTTAG | ATCAATAATGACT    c.4140
 L  P  K  E  Q  T  R  F  N  R  V  D  E  D  F  R  |  S  I  M  T      p.1380

          .         .         .         .         .         .       g.54319
 GATATCAAGAAAGACAATAGAGTCACAACATTAACTACTCATGCTGGAATAAGAAATTCT       c.4200
 D  I  K  K  D  N  R  V  T  T  L  T  T  H  A  G  I  R  N  S         p.1400

          .         .         .         .         .         .       g.54379
 CTACTAACAATACTTGATCAGCTTCAAAGATGTCAGAAATCATTAAATGAATTTTTGGAG       c.4260
 L  L  T  I  L  D  Q  L  Q  R  C  Q  K  S  L  N  E  F  L  E         p.1420

  | 28       .         .         .         .         .         .    g.54539
  | GAAAAACGCTCAGCATTCCCAAGATTTTATTTTATTGGTGATGATGACTTATTAGAAATA    c.4320
  | E  K  R  S  A  F  P  R  F  Y  F  I  G  D  D  D  L  L  E  I      p.1440

          .         .         .         .         .         | 29    g.56503
 TTGGGCCAGTCTACCAACCCATCAGTGATTCAGTCTCACCTGAAGAAGCTTTTTGCTG | GT    c.4380
 L  G  Q  S  T  N  P  S  V  I  Q  S  H  L  K  K  L  F  A  G |       p.1460

          .         .         .         .         .         .       g.56563
 ATTAACAGTGTTTGCTTTGATGAGAAATCAAAACATATAACTGCAATGAAATCTTTAGAG       c.4440
 I  N  S  V  C  F  D  E  K  S  K  H  I  T  A  M  K  S  L  E         p.1480

          .         .         .         .         .  | 30      .    g.58606
 GGAGAAGTTGTACCTTTTAAAAATAAAGTTCCTCTATCAAATAATGTAGAG | ACATGGTTG    c.4500
 G  E  V  V  P  F  K  N  K  V  P  L  S  N  N  V  E   | T  W  L      p.1500

          .         .         .         .         .         .       g.58666
 AATGATTTGGCCTTAGAAATGAAGAAAACTTTGGAACAGTTGTTGAAGGAATGTGTTACT       c.4560
 N  D  L  A  L  E  M  K  K  T  L  E  Q  L  L  K  E  C  V  T         p.1520

          .         .         .         .         .  | 31      .    g.61476
 ACTGGGCGAAGTTCTCAAGGTGCAGTTGACCCATCTCTGTTCCCTTCACAG | ATTTTATGC    c.4620
 T  G  R  S  S  Q  G  A  V  D  P  S  L  F  P  S  Q   | I  L  C      p.1540

          .         .         .         .         .         .       g.61536
 TTGGCGGAGCAGATTAAATTCACTGAAGATGTAGAAAATGCTATTAAAGATCATAGTCTT       c.4680
 L  A  E  Q  I  K  F  T  E  D  V  E  N  A  I  K  D  H  S  L         p.1560

          .         .         .         .         .         .       g.61596
 CATCAGATTGAAACACAACTGGTGAATAAGTTAGAGCAATATACTAACATTGATACAAGT       c.4740
 H  Q  I  E  T  Q  L  V  N  K  L  E  Q  Y  T  N  I  D  T  S         p.1580

          .         .   | 32     .         .         .         .    g.64362
 TCTGAGGATCCAGGGAATACTG | AATCGGGCATCCTGGAGCTTAAACTTAAAGCCCTAATT    c.4800
 S  E  D  P  G  N  T  E |   S  G  I  L  E  L  K  L  K  A  L  I      p.1600

          .         .         .         .         .         .       g.64422
 CTTGACATTATCCATAATATTGATGTGGTAAAGCAGTTAAACCAAATTCAGGTTCATACA       c.4860
 L  D  I  I  H  N  I  D  V  V  K  Q  L  N  Q  I  Q  V  H  T         p.1620

          .         .         .         .         .         .       g.64482
 ACTGAAGACTGGGCTTGGAAAAAACAACTTAGATTCTATATGAAAAGTGATCATACATGT       c.4920
 T  E  D  W  A  W  K  K  Q  L  R  F  Y  M  K  S  D  H  T  C         p.1640

          .         .         .         .         | 33         .    g.65689
 TGTGTTCAAATGGTGGATTCTGAATTTCAGTATACTTATGAATATCAG | GGTAATGCTTCC    c.4980
 C  V  Q  M  V  D  S  E  F  Q  Y  T  Y  E  Y  Q   | G  N  A  S      p.1660

          .         .         .         .         .         .       g.65749
 AAACTGGTTTATACTCCACTGACAGACAAGTGCTACTTAACTCTCACTCAAGCCATGAAG       c.5040
 K  L  V  Y  T  P  L  T  D  K  C  Y  L  T  L  T  Q  A  M  K         p.1680

          .         .         .         .         .         .       g.65809
 ATGGGACTTGGAGGAAATCCTTATGGACCAGCTGGAACTGGGAAAACGGAATCAGTAAAG       c.5100
 M  G  L  G  G  N  P  Y  G  P  A  G  T  G  K  T  E  S  V  K         p.1700

          .         .         .         .         .  | 34      .    g.66464
 GCTTTAGGTGGACTTCTTGGAAGACAAGTTTTAGTCTTTAATTGTGATGAG | GGCATCGAT    c.5160
 A  L  G  G  L  L  G  R  Q  V  L  V  F  N  C  D  E   | G  I  D      p.1720

          .         .         .         .         .         .       g.66524
 GTGAAGTCAATGGGACGAATATTTGTTGGTTTGGTGAAGTGTGGGGCCTGGGGTTGTTTT       c.5220
 V  K  S  M  G  R  I  F  V  G  L  V  K  C  G  A  W  G  C  F         p.1740

          .         .         .         .         .         .       g.66584
 GATGAATTTAATAGGCTGGAAGAATCTGTACTGTCAGCAGTTTCTATGCAAATCCAGACA       c.5280
 D  E  F  N  R  L  E  E  S  V  L  S  A  V  S  M  Q  I  Q  T         p.1760

          .         .         .         .         .     | 35   .    g.68657
 ATTCAAGATGCTTTGAAGAATCATAGAACTGTATGTGAACTGCTTGGCAAGGAG | GTAGAA    c.5340
 I  Q  D  A  L  K  N  H  R  T  V  C  E  L  L  G  K  E   | V  E      p.1780

          .         .         .         .         .         .       g.68717
 GTAAATTCTAATTCTGGAATTTTTATCACTATGAATCCTGCTGGAAAAGGTTATGGAGGA       c.5400
 V  N  S  N  S  G  I  F  I  T  M  N  P  A  G  K  G  Y  G  G         p.1800

          .         .         .         .         .         .       g.68777
 AGACAAAAACTGCCTGATAATCTTAAACAGCTTTTCAGGCCCGTAGCTATGTCTCATCCA       c.5460
 R  Q  K  L  P  D  N  L  K  Q  L  F  R  P  V  A  M  S  H  P         p.1820

          .         .         .         .         .         .       g.68837
 GACAATGAGCTTATTGCAGAAGTTATTCTCTATTCGGAAGGCTTTAAAGACGCTAAAGTA       c.5520
 D  N  E  L  I  A  E  V  I  L  Y  S  E  G  F  K  D  A  K  V         p.1840

          .         .         .         | 36         .         .    g.69646
 TTGAGCAGAAAATTGGTAGCTATTTTCAATCTATCTAG | GGAACTTTTGACACCTCAGCAA    c.5580
 L  S  R  K  L  V  A  I  F  N  L  S  R  |  E  L  L  T  P  Q  Q      p.1860

          .         .         .         .         .         .       g.69706
 CATTATGATTGGGGTTTGAGAGCTTTGAAGACAGTTCTGAGAGGAAGTGGAAATCTCCTT       c.5640
 H  Y  D  W  G  L  R  A  L  K  T  V  L  R  G  S  G  N  L  L         p.1880

          .         .         .     | 37   .         .         .    g.71830
 AGACAGCTAAACAAAAGTGGCACTACACAGAATG | CTAATGAAAGTCATATTGTGGTACAA    c.5700
 R  Q  L  N  K  S  G  T  T  Q  N  A |   N  E  S  H  I  V  V  Q      p.1900

          .         .         .         .         .         .       g.71890
 GCACTGAGGCTTAATACCATGTCAAAGTTTACGTTTACTGATTGCACCCGGTTTGATGCA       c.5760
 A  L  R  L  N  T  M  S  K  F  T  F  T  D  C  T  R  F  D  A         p.1920

          .         .         .         .         .         .       g.71950
 CTGATAAAAGATGTCTTTCCGGGAATTGAATTGAAAGAAGTGGAATATGATGAACTAAGT       c.5820
 L  I  K  D  V  F  P  G  I  E  L  K  E  V  E  Y  D  E  L  S         p.1940

          .         .         .         .         .     | 38   .    g.73131
 GCTGCATTAAAGCAGGTCTTTGAAGAGGCCAATTATGAAATTATACCCAATCAG | ATCAAA    c.5880
 A  A  L  K  Q  V  F  E  E  A  N  Y  E  I  I  P  N  Q   | I  K      p.1960

          .         .         .         .         .         .       g.73191
 AAGGCTTTAGAATTGTATGAACAGTTATGCCAGAGGATGGGAGTTGTTATTGTTGGTCCA       c.5940
 K  A  L  E  L  Y  E  Q  L  C  Q  R  M  G  V  V  I  V  G  P         p.1980

          .         .         .         .         .         .       g.73251
 AGTGGTGCTGGAAAATCAACGCTTTGGAGAATGTTAAGGGCTGCGCTTTGTAAAACTGGC       c.6000
 S  G  A  G  K  S  T  L  W  R  M  L  R  A  A  L  C  K  T  G         p.2000

          .         .         .         .         .         .       g.73311
 AAAGTAGTGAAACAATATACTATGAATCCCAAAGCTATGCCTCGATATCAATTATTAGGC       c.6060
 K  V  V  K  Q  Y  T  M  N  P  K  A  M  P  R  Y  Q  L  L  G         p.2020

          .         .         .         .         .         .       g.73371
 CATATTGACATGGACACAAGAGAATGGTCTGATGGTGTTTTGACAAATAGTGCTCGTCAA       c.6120
 H  I  D  M  D  T  R  E  W  S  D  G  V  L  T  N  S  A  R  Q         p.2040

          .          | 39        .         .         .         .    g.74636
 GTGGTTCGGGAACCTCAAG | ATGTCAGCTCATGGATAATCTGTGATGGTGATATTGACCCT    c.6180
 V  V  R  E  P  Q  D |   V  S  S  W  I  I  C  D  G  D  I  D  P      p.2060

          .         .         .         .         .         .       g.74696
 GAATGGATAGAATCTCTGAATTCTGTTCTGGATGATAATCGACTGCTGACTATGCCCAGT       c.6240
 E  W  I  E  S  L  N  S  V  L  D  D  N  R  L  L  T  M  P  S         p.2080

          .         .         .         .         .         .       g.74756
 GGAGAAAGGATTCAGTTTGGCCCAAATGTTAACTTTGTATTTGAAACTCATGATTTAAGT       c.6300
 G  E  R  I  Q  F  G  P  N  V  N  F  V  F  E  T  H  D  L  S         p.2100

          .         .         .         .        | 40.         .    g.77339
 TGTGCATCACCAGCCACAATATCTAGAATGGGAATGATCTTTCTTAG | TGATGAAGAGACA    c.6360
 C  A  S  P  A  T  I  S  R  M  G  M  I  F  L  S  |  D  E  E  T      p.2120

          .         .         .         .         .         .       g.77399
 GATCTTAATTCTCTGATAAAATCTTGGTTGAGGAATCAGCCTGCTGAATATAGAAATAAT       c.6420
 D  L  N  S  L  I  K  S  W  L  R  N  Q  P  A  E  Y  R  N  N         p.2140

          .         .         .         .         .        | 41.    g.80468
 CTTGAAAATTGGATTGGAGATTATTTTGAAAAGGCTTTACAATGGGTTCTAAAGCAG | AAT    c.6480
 L  E  N  W  I  G  D  Y  F  E  K  A  L  Q  W  V  L  K  Q   | N      p.2160

          .         .         .         .         .         .       g.80528
 GACTATGTGGTAGAAACAAGTTTGGTTGGGACTGTGATGAATGGTTTGTCACATCTACAT       c.6540
 D  Y  V  V  E  T  S  L  V  G  T  V  M  N  G  L  S  H  L  H         p.2180

          .         .         .         .         .         .       g.80588
 GGTTGCAGAGATCATGACGAATTCATTATTAATCTCATAAGGGGACTTGGTGGAAATCTG       c.6600
 G  C  R  D  H  D  E  F  I  I  N  L  I  R  G  L  G  G  N  L         p.2200

          .         .         .    | 42    .         .         .    g.81838
 AATATGAAGTCACGTTTGGAATTTACCAAAGAG | GTTTTTCATTGGGCACGAGAATCTCCT    c.6660
 N  M  K  S  R  L  E  F  T  K  E   | V  F  H  W  A  R  E  S  P      p.2220

          .         .         .         .         .         .       g.81898
 CCAGACTTTCACAAACCTATGGATACCTACTATGACTCTACTAGGGGTCGATTAGCAACA       c.6720
 P  D  F  H  K  P  M  D  T  Y  Y  D  S  T  R  G  R  L  A  T         p.2240

          .         .         .         .         .         .       g.81958
 TATGTGCTTAAGAAGCCAGAAGACTTGACTGCTGATGATTTCAGTAACGGCTTAACTCTT       c.6780
 Y  V  L  K  K  P  E  D  L  T  A  D  D  F  S  N  G  L  T  L         p.2260

          .         .         .         .         .         .       g.82018
 CCAGTCATTCAGACTCCTGACATGCAACGAGGTCTAGATTATTTCAAACCATGGTTAAGT       c.6840
 P  V  I  Q  T  P  D  M  Q  R  G  L  D  Y  F  K  P  W  L  S         p.2280

          .         .         .         .         .    | 43    .    g.82916
 TCTGATACTAAACAGCCCTTTATTCTGGTAGGACCAGAAGGATGTGGCAAAGG | GATGCTG    c.6900
 S  D  T  K  Q  P  F  I  L  V  G  P  E  G  C  G  K  G  |  M  L      p.2300

          .         .         .         .         .         .       g.82976
 CTCAGGTACGCATTTTCACAACTCCGGTCCACTCAAATTGCTACAGTTCACTGTAGTGCA       c.6960
 L  R  Y  A  F  S  Q  L  R  S  T  Q  I  A  T  V  H  C  S  A         p.2320

          .         .         .         .         .         .       g.83036
 CAAACCACTTCTCGACATCTCCTGCAGAAACTGAGCCAGACTTGCATGGTAATCAGTACT       c.7020
 Q  T  T  S  R  H  L  L  Q  K  L  S  Q  T  C  M  V  I  S  T         p.2340

          .         .         .         .         .         .       g.83096
 AATACTGGTCGTGTATACAGACCAAAAGACTGTGAAAGACTTGTTCTGTACTTAAAAGAT       c.7080
 N  T  G  R  V  Y  R  P  K  D  C  E  R  L  V  L  Y  L  K  D         p.2360

          .         .         .         .         .         .       g.83156
 ATCAACCTACCTAAACTTGATAAATGGGGGACCAGTACTTTGGTAGCATTCCTACAACAG       c.7140
 I  N  L  P  K  L  D  K  W  G  T  S  T  L  V  A  F  L  Q  Q         p.2380

  | 44       .         .         .         .         .         .    g.84126
  | GTATTGACGTATCAAGGATTTTATGATGAAAATTTGGAATGGGTTGGTCTAGAAAATATT    c.7200
  | V  L  T  Y  Q  G  F  Y  D  E  N  L  E  W  V  G  L  E  N  I      p.2400

          .         .         .         .         .         .       g.84186
 CAAATTGTGGCTTCTATGTCAGCTGGAGGAAGACTGGGAAGACATAAACTTACTACCAGA       c.7260
 Q  I  V  A  S  M  S  A  G  G  R  L  G  R  H  K  L  T  T  R         p.2420

          .         .         .   | 45     .         .         .    g.85269
 TTTACTTCCATCGTTCGTCTTTGTTCTATAGA | TTACCCAGAAAGAGAGCAGTTACAAACG    c.7320
 F  T  S  I  V  R  L  C  S  I  D  |  Y  P  E  R  E  Q  L  Q  T      p.2440

          .         .         .         .         .         .       g.85329
 ATTTATGGAGCATATTTGGAACCAGTTCTACATAAAAATCTGAAGAATCATTCTATTTGG       c.7380
 I  Y  G  A  Y  L  E  P  V  L  H  K  N  L  K  N  H  S  I  W         p.2460

          .         .         .         .         .        | 46.    g.87089
 GGTTCTTCATCAAAAATTTATCTTTTAGCAGGATCTATGGTACAAGTGTATGAACAG | GTG    c.7440
 G  S  S  S  K  I  Y  L  L  A  G  S  M  V  Q  V  Y  E  Q   | V      p.2480

          .         .         .         .         .         .       g.87149
 CGAGCCAAATTTACAGTTGATGATTATAGTCACTATTTCTTTACTCCTTGCATTCTTACC       c.7500
 R  A  K  F  T  V  D  D  Y  S  H  Y  F  F  T  P  C  I  L  T         p.2500

          .         .         .         . | 47       .         .    g.87686
 CAATGGGTTCTTGGCTTATTTAGATATGATTTAGAAGGAG | GATCCTCAAACCATCCACTA    c.7560
 Q  W  V  L  G  L  F  R  Y  D  L  E  G  G |   S  S  N  H  P  L      p.2520

          .         .         .         .         .         .       g.87746
 GATTATGTGTTAGAAATTGTAGCATATGAGGCACGGCGCTTATTTCGTGACAAAATTGTT       c.7620
 D  Y  V  L  E  I  V  A  Y  E  A  R  R  L  F  R  D  K  I  V         p.2540

          .         .         .         .         .         .       g.87806
 GGTGCAAAGGAACTTCATTTATTTGACATCATTTTAACATCAGTGTTTCAAGGAGATTGG       c.7680
 G  A  K  E  L  H  L  F  D  I  I  L  T  S  V  F  Q  G  D  W         p.2560

          .         .         | 48         .         .         .    g.93534
 GGCTCAGACATATTAGACAATATGTCAG | ATAGTTTCTACGTTACATGGGGAGCTCGGCAT    c.7740
 G  S  D  I  L  D  N  M  S  D |   S  F  Y  V  T  W  G  A  R  H      p.2580

          .         .         .         .         .         .       g.93594
 AATTCAGGAGCAAGGGCAGCCCCAGGACAACCATTACCTCCACATGGAAAACCACTTGGA       c.7800
 N  S  G  A  R  A  A  P  G  Q  P  L  P  P  H  G  K  P  L  G         p.2600

          .         .         .          | 49        .         .    g.94818
 AAACTAAACTCTACTGATCTCAAGGATGTTATTAAAAAG | GGTCTTATTCATTATGGACGA    c.7860
 K  L  N  S  T  D  L  K  D  V  I  K  K   | G  L  I  H  Y  G  R      p.2620

          .         .         .         .         .         .       g.94878
 GATAACCAGAATTTAGACATTTTACTTTTCCACGAAGTCTTGGAGTATATGTCTAGGATA       c.7920
 D  N  Q  N  L  D  I  L  L  F  H  E  V  L  E  Y  M  S  R  I         p.2640

          .         .         .         .         .         .       g.94938
 GATAGAGTGCTGAGTTTCCCTGGAGGTTCACTTCTATTAGCAGGACGCAGTGGTGTAGGT       c.7980
 D  R  V  L  S  F  P  G  G  S  L  L  L  A  G  R  S  G  V  G         p.2660

          .         .         .         .         .         .       g.94998
 CGTCGGACCATCACTTCTTTAGTCAGTCACATGCATGGAGCGGTCCTGTTTTCTCCAAAG       c.8040
 R  R  T  I  T  S  L  V  S  H  M  H  G  A  V  L  F  S  P  K         p.2680

          .         .         .         .         | 50         .    g.95627
 ATTTCCAGAGGATATGAACTGAAGCAGTTCAAAAATGATCTCAAACAT | GTGCTGCAACTT    c.8100
 I  S  R  G  Y  E  L  K  Q  F  K  N  D  L  K  H   | V  L  Q  L      p.2700

          .         .         .         .         .         .       g.95687
 GCAGGAATTGAAGCACAACAGGTAGTTTTACTTCTTGAGGATTACCAGTTTGTACATCCT       c.8160
 A  G  I  E  A  Q  Q  V  V  L  L  L  E  D  Y  Q  F  V  H  P         p.2720

          .         .         .        | 51.         .         .    g.99255
 ACATTTTTGGAGATGATCAATAGCCTTTTGTCTTCAG | GTGAAGTTCCTGGACTCTATACT    c.8220
 T  F  L  E  M  I  N  S  L  L  S  S  G |   E  V  P  G  L  Y  T      p.2740

          .         .         .         .         .         .       g.99315
 CTTGAAGAATTAGAGCCCTTGCTGTTACCACTTAAGGATCAAGCTTCACAAGATGGTTTT       c.8280
 L  E  E  L  E  P  L  L  L  P  L  K  D  Q  A  S  Q  D  G  F         p.2760

          .         .         .  | 52      .         .         .    g.100420
 TTTGGACCAGTCTTCAATTACTTCACATATA | GAATTCAGCAAAACTTGCATATTGTCTTG    c.8340
 F  G  P  V  F  N  Y  F  T  Y  R |   I  Q  Q  N  L  H  I  V  L      p.2780

          .         .         .         .         .         .       g.100480
 ATAATGGATTCTGCAAATTCAAACTTCATGATAAACTGTGAGAGTAATCCAGCTTTGCAT       c.8400
 I  M  D  S  A  N  S  N  F  M  I  N  C  E  S  N  P  A  L  H         p.2800

          .         .         .         .         .     | 53   .    g.105451
 AAGAAATGCCAGGTGTTGTGGATGGAGGGTTGGTCCAATAGCAGTATGAAGAAA | ATACCT    c.8460
 K  K  C  Q  V  L  W  M  E  G  W  S  N  S  S  M  K  K   | I  P      p.2820

          .         .         .         .         .         .       g.105511
 GAAATGTTATTCAGTGAAACAGGTGGTGGAGAAAAATACAATGATAAAAAACGAAAAGAA       c.8520
 E  M  L  F  S  E  T  G  G  G  E  K  Y  N  D  K  K  R  K  E         p.2840

          .          | 54        .         .         .         .    g.107399
 GAAAAGAAAAAAAATTCAG | TTGATCCTGATTTTCTAAAATCATTTTTATTAATCCATGAA    c.8580
 E  K  K  K  N  S  V |   D  P  D  F  L  K  S  F  L  L  I  H  E      p.2860

          .         .         .         .         .         .       g.107459
 TCTTGTAAAGCATATGGTGCTACACCAAGCCGATACATGACCTTTTTACATGTGTATTCT       c.8640
 S  C  K  A  Y  G  A  T  P  S  R  Y  M  T  F  L  H  V  Y  S         p.2880

          .         .         .         .         .     | 55   .    g.111296
 GCCATTAGTAGTAGCAAGAAAAAGGAATTATTAAAAAGACAAAGTCATTTGCAG | GCTGGT    c.8700
 A  I  S  S  S  K  K  K  E  L  L  K  R  Q  S  H  L  Q   | A  G      p.2900

          .         .         .         .         .         .       g.111356
 GTATCTAAACTAAATGAAGCTAAAGCTCTTGTGGATGAACTGAACAGAAAAGCTGGAGAA       c.8760
 V  S  K  L  N  E  A  K  A  L  V  D  E  L  N  R  K  A  G  E         p.2920

          .         .         .         .         .         .       g.111416
 CAAAGTGTGTTACTTAAAACGAAGCAAGATGAAGCAGATGCTGCCCTTCAAATGATCACA       c.8820
 Q  S  V  L  L  K  T  K  Q  D  E  A  D  A  A  L  Q  M  I  T         p.2940

          .   | 56     .         .         .         .         .    g.115532
 GTGTCAATGCAG | GATGCTAGTGAGCAAAAAACAGAACTTGAAAGACTGAAGCACAGAATA    c.8880
 V  S  M  Q   | D  A  S  E  Q  K  T  E  L  E  R  L  K  H  R  I      p.2960

          .         .         .         .         .         .       g.115592
 GCAGAAGAAGTTGTTAAAATTGAAGAAAGAAAAAATAAAATTGATGATGAATTAAAAGAA       c.8940
 A  E  E  V  V  K  I  E  E  R  K  N  K  I  D  D  E  L  K  E         p.2980

        | 57 .         .         .         .         .         .    g.116246
 GTACAA | CCTTTAGTCAATGAAGCTAAACTAGCAGTTGGAAACATTAAGCCCGAATCACTT    c.9000
 V  Q   | P  L  V  N  E  A  K  L  A  V  G  N  I  K  P  E  S  L      p.3000

          .         .         .         .         .         .       g.116306
 TCAGAAATTCGCTCACTACGCATGCCACCTGATGTAATTAGAGATATTCTTGAAGGAGTT       c.9060
 S  E  I  R  S  L  R  M  P  P  D  V  I  R  D  I  L  E  G  V         p.3020

          .         .         .         .        | 58.         .    g.117612
 TTAAGGTTGATGGGTATCTTTGATACATCTTGGGTGAGCATGAAAAG | TTTCCTTGCAAAA    c.9120
 L  R  L  M  G  I  F  D  T  S  W  V  S  M  K  S  |  F  L  A  K      p.3040

          .         .         .         .         .         .       g.117672
 AGAGGTGTAAGAGAAGACATAGCAACCTTTGATGCCCGAAATATTTCAAAGGAAATAAGA       c.9180
 R  G  V  R  E  D  I  A  T  F  D  A  R  N  I  S  K  E  I  R         p.3060

          .         .         .         .         .  | 59      .    g.118543
 GAGAGTGTTGAAGAACTTCTTTTTAAAAATAAAGGCTCTTTTGATCCAAAG | AATGCTAAG    c.9240
 E  S  V  E  E  L  L  F  K  N  K  G  S  F  D  P  K   | N  A  K      p.3080

          .         .         .         .         .         .       g.118603
 CGTGCCAGTACTGCAGCTGCACCTTTGGCTGCCTGGGTGAAAGCCAATATTCAGTATTCC       c.9300
 R  A  S  T  A  A  A  P  L  A  A  W  V  K  A  N  I  Q  Y  S         p.3100

          .         .         .         .         .    | 60    .    g.126836
 CATGTCTTGGAACGAATTCATCCTTTGGAAACTGAACAGGCAGGATTAGAATC | GAATCTG    c.9360
 H  V  L  E  R  I  H  P  L  E  T  E  Q  A  G  L  E  S  |  N  L      p.3120

          .         .         .         .         .         .       g.126896
 AAGAAAACTGAAGACAGAAAAAGGAAACTAGAGGAGCTTCTTAATTCTGTTGGTCAAAAG       c.9420
 K  K  T  E  D  R  K  R  K  L  E  E  L  L  N  S  V  G  Q  K         p.3140

          .         . | 61       .         .         .         .    g.129643
 GTATCAGAACTCAAAGAAAA | ATTTCAGAGCAGGACTTCAGAAGCTGCCAAACTTGAGGCT    c.9480
 V  S  E  L  K  E  K  |  F  Q  S  R  T  S  E  A  A  K  L  E  A      p.3160

          .         .         .         .         .         .       g.129703
 GAAGTAAGCAAGGCACAAGAAACAATCAAAGCTGCAGAAGTCTTAATTAATCAGCTTGAC       c.9540
 E  V  S  K  A  Q  E  T  I  K  A  A  E  V  L  I  N  Q  L  D         p.3180

          .         .        | 62.         .         .         .    g.131274
 AGAGAACATAAGAGATGGAATGCACAG | GTTGTAGAGATAACAGAGGAATTAGCTACTCTT    c.9600
 R  E  H  K  R  W  N  A  Q   | V  V  E  I  T  E  E  L  A  T  L      p.3200

          .         .         .         .         .         .       g.131334
 CCTAAAAGAGCTCAACTTGCTGCTGCATTTATTACATATCTTTCTGCTGCTCCTGAATCT       c.9660
 P  K  R  A  Q  L  A  A  A  F  I  T  Y  L  S  A  A  P  E  S         p.3220

          .         .         .         .          | 63        .    g.132010
 CTGAGAAAAACCTGTTTGGAAGAATGGACCAAGTCAGCTGGTCTTGAGA | AATTTGATCTG    c.9720
 L  R  K  T  C  L  E  E  W  T  K  S  A  G  L  E  K |   F  D  L      p.3240

          .         .         .         .         .         .       g.132070
 AGGAGATTTCTTTGTACTGAAAGTGAGCAGTTAATTTGGAAAAGTGAAGGCCTACCATCA       c.9780
 R  R  F  L  C  T  E  S  E  Q  L  I  W  K  S  E  G  L  P  S         p.3260

          .         .         .          | 64        .         .    g.137117
 GATGACCTTTCCATAGAAAATGCTCTTGTAATATTACAG | ATCATTGGTTTGAAATCATGG    c.9840
 D  D  L  S  I  E  N  A  L  V  I  L  Q   | I  I  G  L  K  S  W      p.3280

  | 65       .         .         .         .         .         .    g.139322
  | AGTCGAGTGTGCCCATTTCTTATAGATCCTTCTTCCCAAGCTACAGAGTGGTTAAAAACA    c.9900
  | S  R  V  C  P  F  L  I  D  P  S  S  Q  A  T  E  W  L  K  T      p.3300

          .         .         .          | 66        .         .    g.140841
 CATTTGAAAGACTCACGTTTAGAAGTTATCAATCAGCAG | GATAGTAACTTTATCACAGCT    c.9960
 H  L  K  D  S  R  L  E  V  I  N  Q  Q   | D  S  N  F  I  T  A      p.3320

          .         .         .         .         .         .       g.140901
 CTTGAATTAGCAGTACGTTTTGGGAAAACCCTTATTATACAAGAGATGGATGGTGTAGAA       c.10020
 L  E  L  A  V  R  F  G  K  T  L  I  I  Q  E  M  D  G  V  E         p.3340

          .         .         .         .    | 67    .         .    g.148871
 CCTGTTCTTTATCCATTATTGAGACGAGATCTGGTTGCTCAAG | GACCACGTTATGTGGTA    c.10080
 P  V  L  Y  P  L  L  R  R  D  L  V  A  Q  G |   P  R  Y  V  V      p.3360

          .         .         .         .         .         .       g.148931
 CAAATAGGTGACAAAATTATTGACTACAATGAAGAATTCCGCCTCTTTTTGTCAACAAGA       c.10140
 Q  I  G  D  K  I  I  D  Y  N  E  E  F  R  L  F  L  S  T  R         p.3380

          .         .         .         .         .         .       g.148991
 AACCCAAATCCTTTTATTCCACCGGATGCAGCTTCCATTGTTACTGAGGTTAACTTTACT       c.10200
 N  P  N  P  F  I  P  P  D  A  A  S  I  V  T  E  V  N  F  T         p.3400

          .         .        | 68.         .         .         .    g.151017
 ACAACAAGAAGTGGATTACGAGGGCAG | CTTTTAGCTTTAACCATTCAGCATGAGAAACCT    c.10260
 T  T  R  S  G  L  R  G  Q   | L  L  A  L  T  I  Q  H  E  K  P      p.3420

          .         .         .         .         .         .       g.151077
 GATTTAGAAGAACAGAAAACAAAACTATTACAACAGGAAGAAGATAAGAAAATACAGCTA       c.10320
 D  L  E  E  Q  K  T  K  L  L  Q  Q  E  E  D  K  K  I  Q  L         p.3440

          .         .        | 69.         .         .         .    g.151708
 GCCAAGCTCGAAGAATCTCTTCTAGAG | ACACTTGCCACATCTCAAGGCAATATTTTGGAA    c.10380
 A  K  L  E  E  S  L  L  E   | T  L  A  T  S  Q  G  N  I  L  E      p.3460

          .         .         .         .         .         .       g.151768
 AATAAGGATTTGATTGAGTCTTTGAATCAGACAAAAGCAAGCAGTGCACTTATTCAAGAG       c.10440
 N  K  D  L  I  E  S  L  N  Q  T  K  A  S  S  A  L  I  Q  E         p.3480

          .         .         .         .   | 70     .         .    g.153195
 TCACTTAAAGAATCTTACAAACTCCAAATTTCCCTTGATCAA | GAACGGGATGCCTATCTC    c.10500
 S  L  K  E  S  Y  K  L  Q  I  S  L  D  Q   | E  R  D  A  Y  L      p.3500

          .         .         .         .         .         .       g.153255
 CCCCTGGCTGAGAGTGCCAGCAAGATGTACTTCATTATTTCTGATTTGTCCAAAATTAAT       c.10560
 P  L  A  E  S  A  S  K  M  Y  F  I  I  S  D  L  S  K  I  N         p.3520

          .         .         .         .         .         .       g.153315
 AACATGTACCGTTTTAGTTTGGCTGCTTTTCTCCGACTTTTCCAACGAGCTCTACAAAAC       c.10620
 N  M  Y  R  F  S  L  A  A  F  L  R  L  F  Q  R  A  L  Q  N         p.3540

        | 71 .         .         .         .         .         .    g.155511
 AAACAG | GATTCTGAAAATACAGAACAGAGAATCCAGTCACTTATCAGCTCATTACAACAT    c.10680
 K  Q   | D  S  E  N  T  E  Q  R  I  Q  S  L  I  S  S  L  Q  H      p.3560

          .         .         .       | 72 .         .         .    g.175941
 ATGGTATATGAATATATATGTCGTTGTCTATTTAAG | GCTGATCAGTTGATGTTCGCTTTG    c.10740
 M  V  Y  E  Y  I  C  R  C  L  F  K   | A  D  Q  L  M  F  A  L      p.3580

          .         .         .         .   | 73     .         .    g.177766
 CATTTTGTTCGAGGCATGCATCCTGAACTTTTTCAAGAAAAT | GAATGGGATACGTTTACA    c.10800
 H  F  V  R  G  M  H  P  E  L  F  Q  E  N   | E  W  D  T  F  T      p.3600

          .         .         .    | 74    .         .         .    g.178604
 GGTGTGGTTGTTGGAGACATGTTACGGAAAGCT | GACTCTCAACAAAAAATACGTGATCAG    c.10860
 G  V  V  V  G  D  M  L  R  K  A   | D  S  Q  Q  K  I  R  D  Q      p.3620

          .         .         .         .         .  | 75      .    g.181833
 CTTCCGTCTTGGATAGATCAGGAACGAAGCTGGGCCGTGGCAACATTAAAG | ATTGCTCTC    c.10920
 L  P  S  W  I  D  Q  E  R  S  W  A  V  A  T  L  K   | I  A  L      p.3640

          .         .         .         .         .         .       g.181893
 CCCAGTCTTTATCAGACCCTCTGCTTTGAAGATGCAGCTCTGTGGCGTACTTATTATAAT       c.10980
 P  S  L  Y  Q  T  L  C  F  E  D  A  A  L  W  R  T  Y  Y  N         p.3660

          .         .         .         .         .         .       g.181953
 AATTCAATGTGTGAGCAAGAGTTTCCATCTATCCTTGCAAAGAAAGTTTCCTTATTTCAG       c.11040
 N  S  M  C  E  Q  E  F  P  S  I  L  A  K  K  V  S  L  F  Q         p.3680

     | 76    .         .         .         .         .         .    g.183159
 CAG | ATTCTTGTAGTACAGGCGCTAAGACCGGACAGATTGCAAAGTGCCATGGCTCTTTTT    c.11100
 Q   | I  L  V  V  Q  A  L  R  P  D  R  L  Q  S  A  M  A  L  F      p.3700

          .       | 77 .         .         .         .         .    g.198706
 GCATGTAAAACTCTGG | GACTGAAAGAGGTGTCCCCACTGCCTCTAAATCTCAAACGTTTA    c.11160
 A  C  K  T  L  G |   L  K  E  V  S  P  L  P  L  N  L  K  R  L      p.3720

          .         .         .         .         .         .       g.198766
 TACAAAGAGACACTGGAAATTGAACCCATCTTGATAATTATTTCTCCGGGTGCTGATCCT       c.11220
 Y  K  E  T  L  E  I  E  P  I  L  I  I  I  S  P  G  A  D  P         p.3740

          .         .         .         .         .        | 78.    g.200167
 TCTCAGGAACTTCAAGAACTAGCTAATGCTGAAAGAAGCGGAGAGTGTTATCACCAG | GTT    c.11280
 S  Q  E  L  Q  E  L  A  N  A  E  R  S  G  E  C  Y  H  Q   | V      p.3760

          .         .         .         .         .         .       g.200227
 GCCATGGGTCAAGGTCAAGCTGATTTAGCAATTCAAATGCTAAAAGAATGTGCCCGCAAT       c.11340
 A  M  G  Q  G  Q  A  D  L  A  I  Q  M  L  K  E  C  A  R  N         p.3780

          .         .         .         .         .         .       g.200287
 GGAGACTGGCTCTGTTTGAAGAACTTACATCTTGTGGTATCTTGGCTGCCAGTTCTGGAA       c.11400
 G  D  W  L  C  L  K  N  L  H  L  V  V  S  W  L  P  V  L  E         p.3800

     | 79    .         .         .         .         .         .    g.203347
 AAG | GAATTGAATACTCTTCAACCTAAAGATACCTTTCGTCTTTGGCTCACTGCAGAAGTT    c.11460
 K   | E  L  N  T  L  Q  P  K  D  T  F  R  L  W  L  T  A  E  V      p.3820

          .         .         .         .         .     | 80   .    g.207453
 CATCCCAACTTTACTCCTATTTTACTACAGTCAAGTCTGAAGATAACATATGAG | TCACCT    c.11520
 H  P  N  F  T  P  I  L  L  Q  S  S  L  K  I  T  Y  E   | S  P      p.3840

          .         .         .         .         .         .       g.207513
 CCAGGTTTAAAGAAGAATTTAATGCGTACTTATGAGTCTTGGACTCCTGAGCAAATTAGC       c.11580
 P  G  L  K  K  N  L  M  R  T  Y  E  S  W  T  P  E  Q  I  S         p.3860

          .         .         .         .         .         .       g.207573
 AAAAAAGATAATACACATCGAGCTCATGCTCTCTTCAGTCTTGCATGGTTTCATGCTGCA       c.11640
 K  K  D  N  T  H  R  A  H  A  L  F  S  L  A  W  F  H  A  A         p.3880

          .         .         . | 81       .         .         .    g.212144
 TGTCAAGAAAGAAGAAACTATATTCCTCAG | GGTTGGACAAAGTTTTATGAATTTTCTTTA    c.11700
 C  Q  E  R  R  N  Y  I  P  Q   | G  W  T  K  F  Y  E  F  S  L      p.3900

          .         .         .         .       | 82 .         .    g.216612
 TCAGATCTTCGGGCTGGGTACAACATTATTGACAGACTTTTTGATG | GTGCCAAAGATGTA    c.11760
 S  D  L  R  A  G  Y  N  I  I  D  R  L  F  D  G |   A  K  D  V      p.3920

          .         .         .         .         .         .       g.216672
 CAATGGGAATTTGTACATGGTTTACTTGAAAATGCTATTTATGGAGGACGTATAGACAAC       c.11820
 Q  W  E  F  V  H  G  L  L  E  N  A  I  Y  G  G  R  I  D  N         p.3940

          .         .         .         .         .         .       g.216732
 TATTTTGACCTTAGAGTTCTTCAGTCATACCTGAAGCAGTTTTTTAATTCTTCAGTTATT       c.11880
 Y  F  D  L  R  V  L  Q  S  Y  L  K  Q  F  F  N  S  S  V  I         p.3960

          .         .         .         .         .         .       g.216792
 GATGTATTCAACCAAAGGAACAAGAAAAGCATTTTTCCATATTCCGTATCTCTACCACAA       c.11940
 D  V  F  N  Q  R  N  K  K  S  I  F  P  Y  S  V  S  L  P  Q         p.3980

          .      | 83  .         .         .         .         .    g.219499
 TCCTGCAGCATTTTG | GACTATCGTGCTGTCATTGAGAAAATTCCAGAGGACGACAAACCT    c.12000
 S  C  S  I  L   | D  Y  R  A  V  I  E  K  I  P  E  D  D  K  P      p.4000

          .         .         .         .         .         .       g.219559
 AGTTTCTTTGGTCTGCCTGCCAATATCGCTCGCTCATCTCAGCGCATGATCAGTTCTCAG       c.12060
 S  F  F  G  L  P  A  N  I  A  R  S  S  Q  R  M  I  S  S  Q         p.4020

  | 84       .         .         .         .         .         .    g.253871
  | GTTATTTCACAGTTGAGGATTTTGGGCAGATCCATAACAGCTGGTTCCAAATTTGATAGA    c.12120
  | V  I  S  Q  L  R  I  L  G  R  S  I  T  A  G  S  K  F  D  R      p.4040

          .         .         .         .         .        | 85.    g.295234
 GAAATCTGGTCTAATGAACTTTCTCCTGTCCTCAATCTCTGGAAGAAACTAAACCAG | AAT    c.12180
 E  I  W  S  N  E  L  S  P  V  L  N  L  W  K  K  L  N  Q   | N      p.4060

          .         .         .         .         .         .       g.295294
 TCAAACCTAATACATCAGAAAGTGCCTCCTCCTAACGATCGACAAGGATCTCCAATACTG       c.12240
 S  N  L  I  H  Q  K  V  P  P  P  N  D  R  Q  G  S  P  I  L         p.4080

          .         .         .         .         .         .       g.295354
 TCATTCATCATTCTTGAACAATTTAATGCTATTCGTTTAGTACAAAGTGTCCACCAGTCT       c.12300
 S  F  I  I  L  E  Q  F  N  A  I  R  L  V  Q  S  V  H  Q  S         p.4100

          .         .         .         .         .         .       g.295414
 CTTGCTGCTCTCAGCAAAGTCATCAGAGGAACTACTTTACTGAGTTCAGAAGTACAAAAA       c.12360
 L  A  A  L  S  K  V  I  R  G  T  T  L  L  S  S  E  V  Q  K         p.4120

          .         .        | 86.         .         .         .    g.331544
 TTGGCAAGTGCTTTATTAAACCAAAAG | TGTCCTCTCGCATGGCAGAGCAAGTGGGAAGGC    c.12420
 L  A  S  A  L  L  N  Q  K   | C  P  L  A  W  Q  S  K  W  E  G      p.4140

          .         .         .         .         .        | 87.    g.350757
 CCAGAAGATCCCTTACAATACCTGAGAGGTCTTGTTGCCCGTGCCCTTGCAATACAG | AAC    c.12480
 P  E  D  P  L  Q  Y  L  R  G  L  V  A  R  A  L  A  I  Q   | N      p.4160

          .         .         .         .         .         .       g.350817
 TGGGTAGATAAAGCTGAAAAACAGGCTCTTCTCTCTGAAACACTTGACCTATCAGAACTT       c.12540
 W  V  D  K  A  E  K  Q  A  L  L  S  E  T  L  D  L  S  E  L         p.4180

          .         .         .         .        | 88.         .    g.351856
 TTCCATCCAGACACATTTCTTAATGCTCTTCGCCAGGAAACTGCAAG | GGCAGTGGGTCGT    c.12600
 F  H  P  D  T  F  L  N  A  L  R  Q  E  T  A  R  |  A  V  G  R      p.4200

          .         .         .         .         .         .       g.351916
 TCTGTGGATAGCCTTAAATTTGTAGCCTCATGGAAAGGTCGACTGCAAGAAGCAAAGCTA       c.12660
 S  V  D  S  L  K  F  V  A  S  W  K  G  R  L  Q  E  A  K  L         p.4220

           | 89        .         .         .         .         .    g.364208
 CAAATTAAG | ATCAGTGGCTTGTTACTAGAAGGATGTAGTTTTGATGGAAATCAACTTTCT    c.12720
 Q  I  K   | I  S  G  L  L  L  E  G  C  S  F  D  G  N  Q  L  S      p.4240

          .         .         .         .         .         .       g.364268
 GAAAATCAGCTTGATTCTCCCAGCGTGTCATCAGTGCTCCCTTGTTTTATGGGCTGGATT       c.12780
 E  N  Q  L  D  S  P  S  V  S  S  V  L  P  C  F  M  G  W  I         p.4260

        | 90 .         .         .         .         .         .    g.374717
 CCACAG | GATGCATGTGGTCCATATTCTCCGGATGAGTGCATCTCTTTGCCTGTTTACACA    c.12840
 P  Q   | D  A  C  G  P  Y  S  P  D  E  C  I  S  L  P  V  Y  T      p.4280

          .         .         .         .         .         .       g.374777
 AGTGCTGAAAGGGATCGTGTGGTTACCAATATTGATGTTCCATGTGGGGGCAACCAAGAC       c.12900
 S  A  E  R  D  R  V  V  T  N  I  D  V  P  C  G  G  N  Q  D         p.4300

          .         .         .         .                           g.374822
 CAGTGGATTCAGTGTGGAGCAGCTCTATTCCTAAAAAATCAGTAG                      c.12945
 Q  W  I  Q  C  G  A  A  L  F  L  K  N  Q  X                        p.4314

          .         .         .         .         .         .       g.374882
 aatctaatgacaacaaaagccatcttcacaaaagggaacattgattctttaagctttaaa       c.*60

          .         .         .         .         .         .       g.374942
 tcaaacatgtggtcagtctacatttgaaatgttagttcaaaatattaacatatagttatg       c.*120

          .         .         .         .         .         .       g.375002
 ttgttgatgtcactgaaattttaatgtgtaaaagcagcactgtgcatcttttaaagtaat       c.*180

          .         .         .         .         .         .       g.375062
 aaattaatggagttattgttaaaacagagtattcttttgacaacattaaatatttctgtg       c.*240

          .         .         .         .         .         .       g.375122
 agaaagttcacttttccagtggctcaaaaatttgttttaggtcagagattttaagtggta       c.*300

          .         .         .         .         .         .       g.375182
 tattaaccaataataaatattttggctgtcatttgtgtcataattatttaataaaagagc       c.*360

          .         .         .         .         .         .       g.375242
 attcataatttttgcagtcttcccatgactctttttacatactgaagaatgtattataaa       c.*420

          .         .         .         .         .         .       g.375302
 gttataatgaatgtataaaagtatcaacatgaatataattatactatgctaattataata       c.*480

          .         .         .         .         .         .       g.375362
 tacaaatatataattattgtcataattatatacttataactaatatcttaaggtaattca       c.*540

          .         .         .         .         .         .       g.375422
 aataggaataattcaggtgacataataatggaggataaattctggttattaaacattcag       c.*600

          .                                                         g.375432
 cttttttgtg                                                         c.*610

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Dynein, cytoplasmic 2, heavy chain 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 09
©2004-2014 Leiden University Medical Center