emopamil binding protein (sterol isomerase) (EBP) - coding DNA reference sequence

(used for variant description)

(last modified March 14, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_006579.2 in the EBP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007452.1, covering EBP transcript NM_006579.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5025
                                    ccattggctcgctccgtaaggcaag       c.-181

 .         .         .         .         .         .                g.5085
 agaacccactaggggatgagcccgaactagggatgtgacagagcgcgagacccagcctaa       c.-121

 .         .         .         .         .       | 02 .             g.6936
 agagagcccggagccagcgtgggaggccgctgccgtcgcgcgccttg | gtttttctgttcc    c.-61

 .         .         .         .         .         .                g.6996
 ttttttttttttttttttaacttcctgcctatacacacgcagccatcagcccacaaagac       c.-1

          .         .         .         .         .         .       g.7056
 ATGACTACCAACGCGGGCCCCTTGCACCCATACTGGCCTCAGCACCTAAGACTGGACAAC       c.60
 M  T  T  N  A  G  P  L  H  P  Y  W  P  Q  H  L  R  L  D  N         p.20

          .         .         .         .         .         .       g.7116
 TTTGTACCTAATGACCGCCCCACCTGGCATATACTGGCTGGCCTCTTCTCTGTCACAGGG       c.120
 F  V  P  N  D  R  P  T  W  H  I  L  A  G  L  F  S  V  T  G         p.40

          .         .         .         .         .         .       g.7176
 GTCTTAGTCGTGACCACATGGCTGTTGTCAGGTCGTGCTGCGGTTGTCCCATTGGGGACT       c.180
 V  L  V  V  T  T  W  L  L  S  G  R  A  A  V  V  P  L  G  T         p.60

          .         .         .         .         .         .       g.7236
 TGGCGGCGACTGTCCCTGTGCTGGTTTGCAGTGTGTGGGTTCATTCACCTGGTGATCGAG       c.240
 W  R  R  L  S  L  C  W  F  A  V  C  G  F  I  H  L  V  I  E         p.80

          .         .         .         .         .         .       g.7296
 GGCTGGTTCGTTCTCTACTACGAAGACCTGCTTGGAGACCAAGCCTTCTTATCTCAACTC       c.300
 G  W  F  V  L  Y  Y  E  D  L  L  G  D  Q  A  F  L  S  Q  L         p.100

   | 03      .         .         .         | 04         .         . g.10401
 T | GGAAAGAGTATGCCAAGGGAGACAGCCGATACATCCT | GGGTGACAACTTCACAGTGTGC c.360
 W |   K  E  Y  A  K  G  D  S  R  Y  I  L  |  G  D  N  F  T  V  C   p.120

          .         .         .         .         .         .       g.10461
 ATGGAAACCATCACAGCTTGCCTGTGGGGACCACTCAGCCTGTGGGTGGTGATCGCCTTT       c.420
 M  E  T  I  T  A  C  L  W  G  P  L  S  L  W  V  V  I  A  F         p.140

          .         .         .         .          | 05        .    g.11469
 CTCCGCCAGCATCCCCTCCGCTTCATTCTACAGCTTGTGGTCTCTGTGG | GCCAGATCTAT    c.480
 L  R  Q  H  P  L  R  F  I  L  Q  L  V  V  S  V  G |   Q  I  Y      p.160

          .         .         .         .         .         .       g.11529
 GGGGATGTGCTCTACTTCCTGACAGAGCACCGCGACGGATTCCAGCACGGAGAGCTGGGC       c.540
 G  D  V  L  Y  F  L  T  E  H  R  D  G  F  Q  H  G  E  L  G         p.180

          .         .         .         .         .         .       g.11589
 CACCCTCTCTACTTCTGGTTTTACTTTGTCTTCATGAATGCCCTGTGGCTGGTGCTGCCT       c.600
 H  P  L  Y  F  W  F  Y  F  V  F  M  N  A  L  W  L  V  L  P         p.200

          .         .         .         .         .         .       g.11649
 GGAGTCCTTGTGCTTGATGCTGTGAAGCACCTCACTCATGCCCAGAGCACGCTGGATGCC       c.660
 G  V  L  V  L  D  A  V  K  H  L  T  H  A  Q  S  T  L  D  A         p.220

          .         .         .                                     g.11682
 AAGGCCACAAAAGCCAAGAGCAAGAAGAACTGA                                  c.693
 K  A  T  K  A  K  S  K  K  N  X                                    p.230

          .         .         .         .         .         .       g.11742
 ggagtggtggaccaggctcgaacactggccgaggaggagctctctgcctgccagaagagt       c.*60

          .         .         .         .         .         .       g.11802
 ctagtcctgctcccacagtttggagggacaaagctaattgatctgtcacactcaggctca       c.*120

          .         .         .         .         .         .       g.11862
 tgggcaggcacaagaaggggaataaaggggctgtgtgaaggcactgctgggagccattag       c.*180

          .         .         .         .         .         .       g.11922
 aacacagatacaagagaagccaggaggtctatgatggtgacgatttttaaaatcaggaaa       c.*240

          .                                                         g.11941
 taaaagatcttgactctaa                                                c.*259

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Emopamil binding protein (sterol isomerase) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.