EDAR-associated death domain (EDARADD) - coding DNA reference sequence

(used for variant description)

(last modified June 17, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_145861.2 in the EDARADD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011566.1, covering EDARADD transcript NM_145861.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5005
                                                        ctcgc       c.-61

 .         .         .         .         .         .                g.5065
 aatctgttgcttcttccatggcaaactccagagaattaagaagccaaactcaacatcgcc       c.-1

          .         .         .         .         .         .       g.5125
 ATGGGCCTCAGGACGACTAAACAGATGGGGAGAGGCACTAAAGCTCCTGGTCACCAAGAG       c.60
 M  G  L  R  T  T  K  Q  M  G  R  G  T  K  A  P  G  H  Q  E         p.20

   | 02      .         .         .         .         .         .    g.19895
 G | ATCATATGGTAAAGGAACCAGTGGAAGACACAGACCCTAGCACTTTATCCTTTAATATG    c.120
 D |   H  M  V  K  E  P  V  E  D  T  D  P  S  T  L  S  F  N  M      p.40

  | 03       .         .         .         . | 04       .         . g.38032
  | TCAGACAAATATCCCATTCAAGATACGGAACTCCCTAAAG | CTGAAGAATGTGATACAATT c.180
  | S  D  K  Y  P  I  Q  D  T  E  L  P  K  A |   E  E  C  D  T  I   p.60

          .         .         .          | 05        .         .    g.78872
 ACTTTGAACTGCCCACGAAATTCAGATATGAAAAATCAG | GGAGAAGAAAATGGCTTTCCA    c.240
 T  L  N  C  P  R  N  S  D  M  K  N  Q   | G  E  E  N  G  F  P      p.80

          .         .      | 06  .         .         .         .    g.92922
 GATAGCACTGGAGATCCTCTTCCAG | AGATCAGCAAGGACAACTCCTGCAAAGAAAACTGT    c.300
 D  S  T  G  D  P  L  P  E |   I  S  K  D  N  S  C  K  E  N  C      p.100

          .         .         .         .         .         .       g.92982
 ACTTGTTCCTCCTGCTTGCTCCGGGCCCCCACCATAAGTGACTTGCTCAATGATCAGGAC       c.360
 T  C  S  S  C  L  L  R  A  P  T  I  S  D  L  L  N  D  Q  D         p.120

          .         .         .         .         .         .       g.93042
 TTACTAGACGTGATCAGGATAAAGCTGGATCCGTGTCACCCAACGGTGAAAAACTGGAGG       c.420
 L  L  D  V  I  R  I  K  L  D  P  C  H  P  T  V  K  N  W  R         p.140

          .         .         .         .         .         .       g.93102
 AATTTTGCAAGCAAATGGGGGATGTCCTATGACGAATTGTGCTTCCTGGAGCAGAGGCCA       c.480
 N  F  A  S  K  W  G  M  S  Y  D  E  L  C  F  L  E  Q  R  P         p.160

          .         .         .         .         .         .       g.93162
 CAGAGCCCCACCTTGGAGTTCTTGCTCCGGAACAGTCAGAGGACGGTGGGCCAGCTGATG       c.540
 Q  S  P  T  L  E  F  L  L  R  N  S  Q  R  T  V  G  Q  L  M         p.180

          .         .         .         .         .         .       g.93222
 GAGCTCTGCAGGCTCTACCACAGGGCCGACGTGGAGAAGGTTCTGCGCAGGTGGGTGGAC       c.600
 E  L  C  R  L  Y  H  R  A  D  V  E  K  V  L  R  R  W  V  D         p.200

          .         .         .         .                           g.93270
 GAGGAGTGGCCCAAGCGGGAGCGTGGAGACCCCTCCAGGCACTTCTAG                   c.648
 E  E  W  P  K  R  E  R  G  D  P  S  R  H  F  X                     p.215

          .         .         .         .         .         .       g.93330
 agctcttcttcttccttcattggcctctccggatgttgaaacaaccacaggtcaagaagg       c.*60

          .         .         .         .         .         .       g.93390
 aatgtgaatctgttgttttataagagtttaggacaaggacgtggaacagtggacactggt       c.*120

          .         .         .         .         .         .       g.93450
 tttccccaaagctggcagttttgtggaggggtagcttgtttcggtggtggatctctgttt       c.*180

          .         .         .         .         .         .       g.93510
 atttttgcacatctgttataatttaatattcaaatctggaattaagaaaacatattttct       c.*240

          .         .         .         .         .         .       g.93570
 agtatcctctaagggccaaagtcctacaatcggaatggattcatgccacgttgaagataa       c.*300

          .         .         .         .         .         .       g.93630
 aattatcctctctctgaaatacggtaaagatttaaataggtcctgagactgttgatagcc       c.*360

          .         .         .         .         .         .       g.93690
 ccagacatacccacagcattatatgtaacatctctcctgatcagtgccattcccacggtt       c.*420

          .         .         .         .         .         .       g.93750
 tcaaagaaaacagctacaaggaatgcttacctgagtgtctgcagcaccctccacttctct       c.*480

          .         .         .         .         .         .       g.93810
 cctaggcaatgagacccagtggctagaaattcaccatgtctattctcaagatccatgcca       c.*540

          .         .         .         .         .         .       g.93870
 gggagctctttgactctcgtgggaatcccactgttgaggttgatctcttcacctcagaag       c.*600

          .         .         .         .         .         .       g.93930
 gtctcttcagagctgctgtgcccagtggtgcttcaactggtatctatgaggtcctagagc       c.*660

          .         .         .         .         .         .       g.93990
 tccaggacaatgataagactcgctatatggggaagggtgtctcaaagcctgttgagccca       c.*720

          .         .         .         .         .         .       g.94050
 tcaataaaactattgcacctgtcctggttagcaagaaactgaacgtcacagaacaagaga       c.*780

          .         .         .         .         .         .       g.94110
 agattgacaaacttatgatagagatggatggaacagaaaataaatctaaatttggtgcaa       c.*840

          .         .         .         .         .         .       g.94170
 atgccattctgggagtgtccctcgctgcctgcaaagctagtgctgttgagaagggggttc       c.*900

          .         .         .         .         .         .       g.94230
 ccctgtaccaccacatcgccgacttgtctggcaactccaaagtcatcttgccagtcccgg       c.*960

          .         .         .         .         .         .       g.94290
 tgttcaatgtcatcaatggcagttctcatgctgtcaccaagctggccatgcaggagttca       c.*1020

          .         .         .         .         .         .       g.94350
 tggtcctcccagtcggtgcagcaaacttcagggaagccatgcccattggagcggaggttt       c.*1080

          .         .         .         .         .         .       g.94410
 accacagcctgaagaatgtcatcaaggagaaatatgggaaagatgccaccggtgtggggg       c.*1140

          .         .         .         .         .         .       g.94470
 atggaggcgcgtttgctcccaacatcctggagaataaagaaggcctggagctgctgaaga       c.*1200

          .         .         .         .         .         .       g.94530
 ctgcgattgggaaagctggctacactgataaggtgatcgtcagcatggacgtagaggcct       c.*1260

          .         .         .         .         .         .       g.94590
 ccgagttcttcaggtctggaaagtatgacctggaattcaagtttctcgacgaccccacca       c.*1320

          .         .         .         .         .         .       g.94650
 ggtacatctcacctgactgtctggctgacctgtacaagtccttcatcaaaaactacccag       c.*1380

          .         .         .         .         .         .       g.94710
 tggtgtctactgaagatccctttgaccaggatgactggggagcttggcagaagttcacgg       c.*1440

          .         .         .         .         .         .       g.94770
 ccagtgcaggaatccaggtagtggaggatgatctcagagtgaccaacccaaagaggacag       c.*1500

          .         .         .         .         .         .       g.94830
 cctcggccgtgaatgagaagaagtgcaactgcctcctgctcaaagtgaaccagattcgct       c.*1560

          .         .         .         .         .         .       g.94890
 ctgtgactgagtcccttcaggcgtgcaagctggcccaggccaatggttggtgtgtcatgg       c.*1620

          .         .         .         .         .         .       g.94950
 tgcctcatcattctggggagactgaaaataccttcatcactgacctggtggtggggctgt       c.*1680

          .         .         .         .         .         .       g.95010
 gacctgggcagctcaagactggtgccccttgctgatctgagcgcttggccaagtacaacc       c.*1740

          .         .         .         .         .         .       g.95070
 agctcctcagaattgaagaggagctgggcagcaaggctaagtttgccggcaggaacttca       c.*1800

          .         .         .         .         .         .       g.95130
 gaaaccccccagccaagtaagctgtgggcaggcaagcccttcagtcacctggtggctaat       c.*1860

          .         .         .         .         .         .       g.95190
 tagacccctccccttgtgtcaactccggcagctcaagacccccgagcaacatttgtaggg       c.*1920

          .         .         .         .         .         .       g.95250
 gccgctgctagttagctacccttgcccaccgccgtggagttcgcacctcttccttagaac       c.*1980

          .         .         .         .         .         .       g.95310
 ttctacagaagcaggttgcagtgagccgagattgcgccactgcacaccagtctggagaca       c.*2040

          .                                                         g.95329
 gagtgagagtccgtcccag                                                c.*2059

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The EDAR-associated death domain protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.