endothelin 1 (EDN1) - coding DNA reference sequence

(used for variant description)

(last modified February 16, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_001955.4 in the EDN1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering EDN1 transcript NM_001955.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5034
                           ggagctgtttacccccactctaataggggttcaa       c.-301

 .         .         .         .         .         .                g.5094
 tataaaaagccggcagagagctgtccaagtcagacgcgcctctgcatctgcgccaggcga       c.-241

 .         .         .         .         .         .                g.5154
 acgggtcctgcgcctcctgcagtcccagctctccaccgccgcgtgcgcctgcagacgctc       c.-181

 .         .         .         .         .         .                g.5214
 cgctcgctgccttctctcctggcaggcgctgccttttctccccgttaaaagggcacttgg       c.-121

 .         .         .         .         .         .                g.5274
 gctgaaggatcgctttgagatctgaggaacccgcagcgctttgagggacctgaagctgtt       c.-61

 .         .         .         .         .         .                g.5334
 tttcttcgttttcctttgggttcagtttgaacgggaggtttttgatccctttttttcaga       c.-1

          .         .         .         .         .         .       g.5394
 ATGGATTATTTGCTCATGATTTTCTCTCTGCTGTTTGTGGCTTGCCAAGGAGCTCCAGAA       c.60
 M  D  Y  L  L  M  I  F  S  L  L  F  V  A  C  Q  G  A  P  E         p.20

      | 02   .         .         .         .         .         .    g.7101
 ACAG | CAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACT    c.120
 T  A |   V  L  G  A  E  L  S  A  V  G  E  N  G  G  E  K  P  T      p.40

          .         .         .         .         .         .       g.7161
 CCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGAT       c.180
 P  S  P  P  W  R  L  R  R  S  K  R  C  S  C  S  S  L  M  D         p.60

          .         .         .         .         .    | 03    .    g.8652
 AAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTTGGGTCAACACTCCCGA | GCACGTT    c.240
 K  E  C  V  Y  F  C  H  L  D  I  I  W  V  N  T  P  E  |  H  V      p.80

          .         .         .         .         .         .       g.8712
 GTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCCTTGGAGAATTTACTTCCCACA       c.300
 V  P  Y  G  L  G  S  P  R  S  K  R  A  L  E  N  L  L  P  T         p.100

          .         .         .         .         .         .       g.8772
 AAGGCAACAGACCGTGAAAATAGATGCCAATGTGCTAGCCAAAAAGACAAGAAGTGCTGG       c.360
 K  A  T  D  R  E  N  R  C  Q  C  A  S  Q  K  D  K  K  C  W         p.120

          .         .          | 04        .         .         .    g.8996
 AATTTTTGCCAAGCAGGAAAAGAACTCAG | GGCTGAAGACATTATGGAGAAAGACTGGAAT    c.420
 N  F  C  Q  A  G  K  E  L  R  |  A  E  D  I  M  E  K  D  W  N      p.140

          .         .         .         .         .         .       g.9056
 AATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTA       c.480
 N  H  K  K  G  K  D  C  S  K  L  G  K  K  C  I  Y  Q  Q  L         p.160

          .         .         .         .         .    | 05    .    g.10673
 GTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAG | GTCGGAG    c.540
 V  R  G  R  K  I  R  R  S  S  E  E  H  L  R  Q  T  R  |  S  E      p.180

          .         .         .         .         .         .       g.10733
 ACCATGAGAAACAGCGTCAAATCATCTTTTCATGATCCCAAGCTGAAAGGCAAGCCCTCC       c.600
 T  M  R  N  S  V  K  S  S  F  H  D  P  K  L  K  G  K  P  S         p.200

          .         .         .                                     g.10772
 AGAGAGCGTTATGTGACCCACAACCGAGCACATTGGTGA                            c.639
 R  E  R  Y  V  T  H  N  R  A  H  W  X                              p.212

          .         .         .         .         .         .       g.10832
 cagaccttcggggcctgtctgaagccatagcctccacggagagccctgtggccgactctg       c.*60

          .         .         .         .         .         .       g.10892
 cactctccaccctggctgggatcagagcaggagcatcctctgctggttcctgactggcaa       c.*120

          .         .         .         .         .         .       g.10952
 aggaccagcgtcctcgttcaaaacattccaagaaaggttaaggagttcccccaaccatct       c.*180

          .         .         .         .         .         .       g.11012
 tcactggcttccatcagtggtaactgctttggtctcttctttcatctggggatgacaatg       c.*240

          .         .         .         .         .         .       g.11072
 gacctctcagcagaaacacacagtcacattcgaattcgggtggcatcctccggagagaga       c.*300

          .         .         .         .         .         .       g.11132
 gagaggaaggagattccacacaggggtggagtttctgacgaaggtcctaagggagtgttt       c.*360

          .         .         .         .         .         .       g.11192
 gtgtctgactcaggcgcctggcacatttcagggagaaactccaaagtccacacaaagatt       c.*420

          .         .         .         .         .         .       g.11252
 ttctaaggaatgcacaaattgaaaacacactcaaaagacaaacatgcaagtaaagaaaaa       c.*480

          .         .         .         .         .         .       g.11312
 aaaaagaaagacttttgtttaaatttgtaaaatgcaaaactgaatgaaactgttactacc       c.*540

          .         .         .         .         .         .       g.11372
 ataaatcaggatatgtttcatgaatatgagtctacctcacctatattgcactctggcaga       c.*600

          .         .         .         .         .         .       g.11432
 agtatttcccacatttaattattgcctccccaaactcttcccacccctgctgccccttcc       c.*660

          .         .         .         .         .         .       g.11492
 tccatcccccatactaaatcctagcctcgtagaagtctggtctaatgtgtcagcagtaga       c.*720

          .         .         .         .         .         .       g.11552
 tataatattttcatggtaatctactagctctgatccataagaaaaaaaagatcattaaat       c.*780

          .         .         .         .         .         .       g.11612
 caggagattccctgtccttgatttttggagacacaatggtatagggttgtttatgaaata       c.*840

          .         .         .         .         .         .       g.11672
 tattgaaaagtaagtgtttgttacgctttaaagcagtaaaattattttcctttatataac       c.*900

          .         .         .         .         .         .       g.11732
 cggctaatgaaagaggttggattgaattttgatgtacttatttttttatagatatttata       c.*960

          .         .         .         .         .         .       g.11792
 ttcaaacaatttattccttatatttaccatgttaaatatctgtttgggcaggccatattg       c.*1020

          .         .         .         .         .         .       g.11852
 gtctatgtatttttaaaatatgtatttctaaatgaaattgagaacatgctttgttttgcc       c.*1080

          .         .         .         .                           g.11899
 tgtcaaggtaatgactttagaaaataaatatttttttccttactgta                    c.*1127

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Endothelin 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.