endothelin 3 (EDN3) - coding DNA reference sequence

(used for variant description)

(last modified October 28, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_207034.1 in the EDN3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008050.1, covering EDN3 transcript NM_207034.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5009
                                                    ctcgggccg       c.-361

 .         .         .         .         .         .                g.5069
 ctgcgctcctggccagctccccccagcgcctgggaggcgacccccagtgcgcccgggttc       c.-301

 .         .         .         .         .         .                g.5129
 aaaggcccggcgaggcagttccagcccctctggggggcggggaggcgacgggggtggtgc       c.-241

 .         .         .         .         .         .                g.5189
 agaagccagaaaagcccgagccacagccggccagctccgcgcagggatgggcagcgcgct       c.-181

 .         .         .         .         .         .                g.5249
 ctgaaagtttatgaccgccgcagccaactcctggccggagctggagacgcagcgagcgat       c.-121

 .         .         .         .         .         .                g.5309
 cggccggcctcgaacccccacagctggagggcgaggccagctgtacccggccccagtgcc       c.-61

 .         .         .         .         .         .                g.5369
 ctttcgcggccacaagcggccgtcctcctggtccggtgctccggcgcctgatctaggttc       c.-1

          .         .         .         .         .   | 02     .    g.5974
 ATGGAGCCGGGGCTGTGGCTCCTTTTCGGGCTCACAGTGACCTCCGCCGCAG | GATTCGTG    c.60
 M  E  P  G  L  W  L  L  F  G  L  T  V  T  S  A  A  G |   F  V      p.20

          .         .         .         .         .         .       g.6034
 CCTTGCTCCCAGTCTGGGGATGCTGGCAGGCGCGGCGTGTCCCAGGCCCCCACTGCAGCC       c.120
 P  C  S  Q  S  G  D  A  G  R  R  G  V  S  Q  A  P  T  A  A         p.40

          .         .         .         .         .         .       g.6094
 AGATCTGAGGGGGACTGTGAAGAGACTGTGGCTGGCCCTGGCGAGGAGACTGTGGCTGGC       c.180
 R  S  E  G  D  C  E  E  T  V  A  G  P  G  E  E  T  V  A  G         p.60

          .         .         .         .         .         .       g.6154
 CCTGGCGAGGGGACTGTGGCCCCGACAGCACTGCAGGGTCCAAGCCCTGGAAGCCCTGGG       c.240
 P  G  E  G  T  V  A  P  T  A  L  Q  G  P  S  P  G  S  P  G         p.80

          .         .         .         .         .         .       g.6214
 CAGGAGCAGGCGGCCGAGGGGGCCCCTGAGCACCACCGATCCAGGCGCTGCACGTGCTTC       c.300
 Q  E  Q  A  A  E  G  A  P  E  H  H  R  S  R  R  C  T  C  F         p.100

          .         .         .         .         .         .       g.6274
 ACCTACAAGGACAAGGAGTGTGTCTACTATTGCCACCTGGACATCATTTGGATCAACACT       c.360
 T  Y  K  D  K  E  C  V  Y  Y  C  H  L  D  I  I  W  I  N  T         p.120

       | 03  .         .         .         .         .         .    g.25628
 CCCGA | ACAGACGGTGCCCTATGGACTGTCCAACTACAGAGGAAGCTTCCGGGGCAAGAGG    c.420
 P  E  |  Q  T  V  P  Y  G  L  S  N  Y  R  G  S  F  R  G  K  R      p.140

          .         .         .         .         .         .       g.25688
 TCTGCGGGGCCACTTCCAGGGAATCTGCAGCTCTCACATCGGCCACACTTGCGCTGCGCT       c.480
 S  A  G  P  L  P  G  N  L  Q  L  S  H  R  P  H  L  R  C  A         p.160

          .         .         .         .         .         .       g.25748
 TGTGTGGGGAGATATGACAAGGCCTGCCTGCACTTTTGCACCCAAACTCTGGACGTCAGC       c.540
 C  V  G  R  Y  D  K  A  C  L  H  F  C  T  Q  T  L  D  V  S         p.180

    | 04     .         .         .         .         | 05         . g.28899
 AG | TAATTCAAGGACGGCAGAAAAAACAGACAAAGAAGAGGAAGGGAAG | GTTGAAGTCAAG c.600
 S  |  N  S  R  T  A  E  K  T  D  K  E  E  E  G  K   | V  E  V  K   p.200

          .         .         .         .         .         .       g.28959
 GACCAACAAAGCAAGCAGGCTTTAGACCTCCACCATCCAAAGCTCATGCCCGGCAGTGGA       c.660
 D  Q  Q  S  K  Q  A  L  D  L  H  H  P  K  L  M  P  G  S  G         p.220

          .         .         .         .         .                 g.29016
 CTCGCCCTCGCTCCATCTACCTGCCCCCGCTGCCTCTTTCAGGAAGGAGCCCCTTAG          c.717
 L  A  L  A  P  S  T  C  P  R  C  L  F  Q  E  G  A  P  X            p.238

          .         .         .         .         .         .       g.29076
 gaggacaggcctgcagcatcctggtctcgggaggcttctgtcattgctcacacacagttc       c.*60

          .         .         .         .         .         .       g.29136
 agatttccacctctttatagacaagaagtgaatttgcctggggcagaacacccacccaaa       c.*120

          .         .         .         .         .         .       g.29196
 gagtccccacttaacaataccccccccccacggcaagaatgcccaaatccgaatgacccc       c.*180

          .         .         .         .         .         .       g.29256
 agttttcctaatgagtaaaatgatcccagatgtgccccagagcatgacgcctgcagctcc       c.*240

          .         .         .         .         .         .       g.29316
 ggtttcatgcaggaaattggttttggagagttttggcaagttggaaagccacttactggc       c.*300

          .         .         .         .         .         .       g.29376
 ttttgacatgacttctcttggagaataagtggactccaagctaactctttgcaaatgtaa       c.*360

          .         .         .         .         .         .       g.29436
 acacatgtccatcttgtaataaatgcaaaatgcccgtgcagcagaagcatgcgactttca       c.*420

          .         .         .         .         .         .       g.29496
 tatccttgcctagaataggctgcatggtgtatgtcagtgagggccacgaggcgtcggctt       c.*480

          .         .         .         .         .         .       g.29556
 tagacacagatcatagctctacaggagtttatgaatttgaagcttatgggattttggcag       c.*540

          .         .         .         .         .         .       g.29616
 agaaattttcagctgtgcttgatacccaccaaaagaatgtatctcgaaagaatgaaggaa       c.*600

          .         .         .         .         .         .       g.29676
 gaagaaaaaaggatccttgatgtttgtgacaagaaaatgagaaagttagtatctgcaata       c.*660

          .         .         .         .         .         .       g.29736
 cagagcttgttcctgttcagtgactgaccctctgtattctgtatagacaccaggccgata       c.*720

          .         .         .         .         .         .       g.29796
 cacagtggagttcccaggccttgtttgcaggaagccgactgtaaagacagccccagctca       c.*780

          .         .         .         .         .         .       g.29856
 aggctattaggttgaatatttgctttcatgagtaaatgtggatctttggggaatggcttc       c.*840

          .         .         .         .         .         .       g.29916
 aaaataagtcacgaacacaaattctttgtaaattatgtaaattcctgtttatataaattg       c.*900

          .         .         .         .         .         .       g.29976
 gcaacaacttataccgtctgacagttcaaaatctctttcagctgcgctcttcccaccgag       c.*960

          .         .         .         .         .         .       g.30036
 ccgagcttactgtgagtgtggagatgttatcccaccatgtaaagtcgcctgcgcagggga       c.*1020

          .         .         .         .         .         .       g.30096
 gggctgcccatctccccaacccagtcacagagagataggaaacggcatttgagtgggtgt       c.*1080

          .         .         .         .         .         .       g.30156
 ccagggccccgtagagagacatttaagatggtgtatgacagagcattggccttgaccaaa       c.*1140

          .         .         .         .         .         .       g.30216
 tgttaaatcctctgtgtgtatttcataagttattacaggtataaaagtgatgacctatca       c.*1200

          .         .         .         .         .         .       g.30276
 tgaggaaatgaaagtggctgatttgctggtaggattttgtacagtttagagaagcgatta       c.*1260

          .         .         .         .         .         .       g.30336
 tttattgtgaaactgttctccactccaactcctttatgtggatctgttcaaagtagtcac       c.*1320

          .         .         .         .         .         .       g.30396
 tgtatatacgtatagagaggtagataggtaggtagattttaaattgcattctgaatacaa       c.*1380

          .         .         .         .         .         .       g.30456
 actcatactccttagagcttgaattacatttttaaaatgcatatgtgctgtttggcaccg       c.*1440

          .         .         .         .         .         .       g.30516
 tggcaagatggtatcagagagaaacccatcaattgctcaaatactcagaaagtactgtca       c.*1500

          .         .         .                                     g.30549
 aaagcctaataaaaaacctaaagtttgctctga                                  c.*1533

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Endothelin 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 25
©2004-2020 Leiden University Medical Center