euchromatic histone-lysine N-methyltransferase 1 (EHMT1) - coding DNA reference sequence

(used for variant description)

(last modified October 15, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_024757.4 in the EHMT1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011776.1, covering EHMT1 transcript NM_024757.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5037
                        gcgcgggaggggcggggccacgctgcgggcccgggcc       c.-1

          .         .  | 02      .         .         .         .    g.97014
 ATGGCCGCCGCCGATGCCGAG | GCAGTTCCGGCGAGGGGGGAGCCTCAGCAGGATTGCTGT    c.60
 M  A  A  A  D  A  E   | A  V  P  A  R  G  E  P  Q  Q  D  C  C      p.20

          .         .      | 03  .         .         .         .    g.102669
 GTGAAAACCGAGCTGCTGGGAGAAG | AGACACCTATGGCTGCCGATGAAGGCTCAGCAGAG    c.120
 V  K  T  E  L  L  G  E  E |   T  P  M  A  A  D  E  G  S  A  E      p.40

          .         .         .         .         .         .       g.102729
 AAACAGGCAGGAGAGGCCCACATGGCTGCGGACGGTGAGACCAATGGGTCTTGTGAAAAC       c.180
 K  Q  A  G  E  A  H  M  A  A  D  G  E  T  N  G  S  C  E  N         p.60

          .         .         .         .         .         .       g.102789
 AGCGATGCCAGCAGTCATGCAAATGCTGCAAAGCACACTCAGGACAGCGCAAGGGTCAAC       c.240
 S  D  A  S  S  H  A  N  A  A  K  H  T  Q  D  S  A  R  V  N         p.80

          .         .         .         .         .         .       g.102849
 CCCCAGGATGGCACCAACACACTAACTCGGATAGCGGAAAATGGGGTTTCAGAAAGAGAC       c.300
 P  Q  D  G  T  N  T  L  T  R  I  A  E  N  G  V  S  E  R  D         p.100

          .         .         .         .         .         .       g.102909
 TCAGAAGCGGCGAAGCAAAACCACGTCACTGCCGACGACTTTGTGCAGACTTCTGTCATC       c.360
 S  E  A  A  K  Q  N  H  V  T  A  D  D  F  V  Q  T  S  V  I         p.120

          .         .         .         .         .         .       g.102969
 GGCAGCAACGGATACATCTTAAATAAGCCGGCCCTACAGGCACAGCCCTTGAGGACTACC       c.420
 G  S  N  G  Y  I  L  N  K  P  A  L  Q  A  Q  P  L  R  T  T         p.140

          .         .         .         .         .         .       g.103029
 AGCACTCTGGCCTCTTCGCTGCCTGGCCATGCTGCAAAAACCCTTCCTGGAGGGGCTGGC       c.480
 S  T  L  A  S  S  L  P  G  H  A  A  K  T  L  P  G  G  A  G         p.160

          .         .         .         .         .         .       g.103089
 AAAGGCAGGACTCCAAGCGCTTTTCCCCAGACGCCAGCCGCCCCACCAGCCACCCTTGGG       c.540
 K  G  R  T  P  S  A  F  P  Q  T  P  A  A  P  P  A  T  L  G         p.180

          .         .         .         .         .         .       g.103149
 GAGGGGAGTGCTGACACAGAGGACAGGAAGCTCCCGGCCCCTGGCGCCGACGTCAAGGTC       c.600
 E  G  S  A  D  T  E  D  R  K  L  P  A  P  G  A  D  V  K  V         p.200

          .         .         .         .   | 04     .         .    g.114375
 CACAGGGCACGCAAGACCATGCCGAAGTCCGTCGTGGGCCTG | CATGCAGCCAGTAAAGAT    c.660
 H  R  A  R  K  T  M  P  K  S  V  V  G  L   | H  A  A  S  K  D      p.220

          .         .         .         .         .         .       g.114435
 CCCAGAGAAGTTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAAC       c.720
 P  R  E  V  R  E  A  R  D  H  K  E  P  K  E  E  I  N  K  N         p.240

          .         .         .         .         .         .       g.114495
 ATTTCTGACTTTGGACGACAGCAGCTTTTACCCCCCTTCCCATCCCTTCATCAGTCGCTA       c.780
 I  S  D  F  G  R  Q  Q  L  L  P  P  F  P  S  L  H  Q  S  L         p.260

          .         .         .         .    | 05    .         .    g.129396
 CCTCAGAACCAGTGCTACATGGCCACCACAAAATCACAGACAG | CTTGCTTGCCTTTTGTT    c.840
 P  Q  N  Q  C  Y  M  A  T  T  K  S  Q  T  A |   C  L  P  F  V      p.280

          .         .         .         .         .         .       g.129456
 TTAGCAGCTGCAGTATCTCGGAAGAAAAAACGAAGAATGGGAACCTATAGCCTGGTTCCT       c.900
 L  A  A  A  V  S  R  K  K  K  R  R  M  G  T  Y  S  L  V  P         p.300

          .         .         .         .         .         .       g.129516
 AAGAAAAAGACCAAAGTATTAAAACAGAGGACGGTGATTGAGATGTTTAAGAGCATAACT       c.960
 K  K  K  T  K  V  L  K  Q  R  T  V  I  E  M  F  K  S  I  T         p.320

          .         .  | 06      .         .         .         .    g.129949
 CATTCCACTGTGGGTTCCAAG | GGGGAGAAGGACCTGGGCGCCAGCAGCCTGCACGTGAAT    c.1020
 H  S  T  V  G  S  K   | G  E  K  D  L  G  A  S  S  L  H  V  N      p.340

          .         .         .         .         .         .       g.130009
 GGGGAGAGCCTGGAGATGGACTCGGATGAGGACGACTCAGAGGAGCTCGAGGAGGACGAC       c.1080
 G  E  S  L  E  M  D  S  D  E  D  D  S  E  E  L  E  E  D  D         p.360

          .         .         .         .         .         .       g.130069
 GGCCATGGTGCAGAGCAGGCGGCCGCGTTCCCCACAGAGGACAGCAGGACTTCCAAGGAG       c.1140
 G  H  G  A  E  Q  A  A  A  F  P  T  E  D  S  R  T  S  K  E         p.380

          .         .         . | 07       .         .         .    g.138369
 AGCATGTCGGAGGCTGATCGCGCCCAGAAG | ATGGACGGGGAGTCCGAGGAGGAGCAGGAG    c.1200
 S  M  S  E  A  D  R  A  Q  K   | M  D  G  E  S  E  E  E  Q  E      p.400

          .         .         .         .         | 08         .    g.140191
 TCCGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTCTGACCTG | AGTTCGGAATCC    c.1260
 S  V  D  T  G  E  E  E  E  G  G  D  E  S  D  L   | S  S  E  S      p.420

          .         .         .         .         .         .       g.140251
 AGCATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCA       c.1320
 S  I  K  K  K  F  L  K  R  K  G  K  T  D  S  P  W  I  K  P         p.440

          .         .         .         .          | 09        .    g.143899
 GCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCG | GTTCTGAGTCG    c.1380
 A  R  K  R  R  R  R  S  R  K  K  P  S  G  A  L  G |   S  E  S      p.460

          .         .         .         .         .         .       g.143959
 TATAAGTCATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATG       c.1440
 Y  K  S  S  A  G  S  A  E  Q  T  A  P  G  D  S  T  G  Y  M         p.480

          .         .         .         .         .         .       g.144019
 GAAGTTTCTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAA       c.1500
 E  V  S  L  D  S  L  D  L  R  V  K  G  I  L  S  S  Q  A  E         p.500

   | 10      .         .         .         .         .         .    g.148742
 G | GGTTGGCCAACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGC    c.1560
 G |   L  A  N  G  P  D  V  L  E  T  D  G  L  Q  E  V  P  L  C      p.520

          .         .         .         .         .         .       g.148802
 AGCTGCCGGATGGAAACACCGAAGAGTCGAGAGATCACCACACTGGCCAACAACCAGTGC       c.1620
 S  C  R  M  E  T  P  K  S  R  E  I  T  T  L  A  N  N  Q  C         p.540

          .         .        | 11.         .         .         .    g.161150
 ATGGCTACAGAGAGCGTGGACCATGAA | TTGGGCCGGTGCACAAACAGCGTGGTCAAGTAT    c.1680
 M  A  T  E  S  V  D  H  E   | L  G  R  C  T  N  S  V  V  K  Y      p.560

          .         .         .         .         .         .       g.161210
 GAGCTGATGCGCCCCTCCAACAAGGCCCCGCTCCTCGTGCTGTGTGAAGACCACCGGGGC       c.1740
 E  L  M  R  P  S  N  K  A  P  L  L  V  L  C  E  D  H  R  G         p.580

          .         .         .         .         .  | 12      .    g.162635
 CGCATGGTGAAGCACCAGTGCTGTCCTGGCTGTGGCTACTTCTGCACAGCG | GGTAATTTT    c.1800
 R  M  V  K  H  Q  C  C  P  G  C  G  Y  F  C  T  A   | G  N  F      p.600

          .         .         .         .         .         .       g.162695
 ATGGAGTGTCAGCCCGAGAGCAGCATCTCTCACCGTTTCCACAAAGACTGTGCCTCTCGA       c.1860
 M  E  C  Q  P  E  S  S  I  S  H  R  F  H  K  D  C  A  S  R         p.620

          .         .         .         .         .         .       g.162755
 GTCAATAACGCCAGCTATTGTCCCCACTGTGGGGAGGAGAGCTCCAAGGCCAAAGAGGTG       c.1920
 V  N  N  A  S  Y  C  P  H  C  G  E  E  S  S  K  A  K  E  V         p.640

          .         .         .         .         .         .       g.162815
 ACGATAGCTAAAGCAGACACCACCTCGACCGTGACACCAGTCCCCGGGCAGGAGAAGGGC       c.1980
 T  I  A  K  A  D  T  T  S  T  V  T  P  V  P  G  Q  E  K  G         p.660

          .         .         .         | 13         .         .    g.163912
 TCGGCCCTGGAGGGCAGGGCCGACACCACAACGGGCAG | TGCTGCCGGGCCACCACTCTCG    c.2040
 S  A  L  E  G  R  A  D  T  T  T  G  S  |  A  A  G  P  P  L  S      p.680

          .         .         .         .         .         .       g.163972
 GAGGACGACAAGCTGCAGGGTGCAGCCTCCCACGTGCCCGAGGGCTTTGATCCAACGGGA       c.2100
 E  D  D  K  L  Q  G  A  A  S  H  V  P  E  G  F  D  P  T  G         p.700

          .         .         .         .         .         .       g.164032
 CCTGCTGGGCTTGGGAGGCCAACTCCCGGCCTTTCCCAGGGACCAGGGAAGGAAACCTTG       c.2160
 P  A  G  L  G  R  P  T  P  G  L  S  Q  G  P  G  K  E  T  L         p.720

          .         .         .   | 14     .         .         .    g.165671
 GAGAGCGCTCTCATCGCCCTCGACTCGGAAAA | ACCCAAGAAGCTTCGCTTCCACCCAAAG    c.2220
 E  S  A  L  I  A  L  D  S  E  K  |  P  K  K  L  R  F  H  P  K      p.740

          .         .         .         .         .      | 15  .    g.168304
 CAGCTGTACTTCTCCGCCAGGCAAGGGGAGCTTCAGAAGGTGCTCCTCATGCTGG | TGGAC    c.2280
 Q  L  Y  F  S  A  R  Q  G  E  L  Q  K  V  L  L  M  L  V |   D      p.760

          .         .         .         .         .         .       g.168364
 GGAATTGACCCCAACTTCAAAATGGAGCACCAGAATAAGCGCTCTCCACTGCACGCCGCG       c.2340
 G  I  D  P  N  F  K  M  E  H  Q  N  K  R  S  P  L  H  A  A         p.780

          .         .         .         .   | 16     .         .    g.176874
 GCAGAGGCTGGACACGTGGACATCTGCCACATGCTGGTTCAG | GCGGGCGCTAATATTGAC    c.2400
 A  E  A  G  H  V  D  I  C  H  M  L  V  Q   | A  G  A  N  I  D      p.800

          .         .         .         .         .         .       g.176934
 ACCTGCTCAGAAGACCAGAGGACCCCGTTGATGGAAGCAGCCGAAAACAACCATCTGGAA       c.2460
 T  C  S  E  D  Q  R  T  P  L  M  E  A  A  E  N  N  H  L  E         p.820

          .         .         .         .      | 17  .         .    g.184836
 GCAGTGAAGTACCTCATCAAGGCTGGGGCCCTGGTGGATCCCAAG | GACGCAGAGGGCTCT    c.2520
 A  V  K  Y  L  I  K  A  G  A  L  V  D  P  K   | D  A  E  G  S      p.840

          .         .         .         .         .         .       g.184896
 ACGTGTTTGCACCTGGCTGCCAAGAAAGGCCACTACGAAGTGGTCCAGTACCTGCTTTCA       c.2580
 T  C  L  H  L  A  A  K  K  G  H  Y  E  V  V  Q  Y  L  L  S         p.860

          .         .        | 18.         .         .         .    g.186921
 AATGGACAGATGGACGTCAACTGTCAG | GATGACGGAGGCTGGACACCCATGATCTGGGCC    c.2640
 N  G  Q  M  D  V  N  C  Q   | D  D  G  G  W  T  P  M  I  W  A      p.880

          .         .         .         .         .         .       g.186981
 ACAGAGTACAAGCACGTGGACCTCGTGAAGCTGCTGCTGTCCAAGGGCTCTGACATCAAC       c.2700
 T  E  Y  K  H  V  D  L  V  K  L  L  L  S  K  G  S  D  I  N         p.900

          .   | 19     .         .         .         .         .    g.197517
 ATCCGAGACAAC | GAGGAGAACATTTGCCTGCACTGGGCGGCGTTCTCCGGCTGCGTGGAC    c.2760
 I  R  D  N   | E  E  N  I  C  L  H  W  A  A  F  S  G  C  V  D      p.920

          .         .         .         .         .         .       g.197577
 ATAGCCGAGATCCTGCTGGCTGCCAAGTGCGACCTCCACGCCGTGAACATCCACGGAGAC       c.2820
 I  A  E  I  L  L  A  A  K  C  D  L  H  A  V  N  I  H  G  D         p.940

          .         .         .         .        | 20.         .    g.199027
 TCGCCACTGCACATTGCCGCCCGGGAGAACCGCTACGACTGTGTCGT | CCTCTTTCTTTCT    c.2880
 S  P  L  H  I  A  A  R  E  N  R  Y  D  C  V  V  |  L  F  L  S      p.960

          .         .         .         .         .         .       g.199087
 CGGGATTCAGATGTCACCTTAAAGAACAAGGAAGGAGAGACGCCCCTGCAGTGTGCGAGC       c.2940
 R  D  S  D  V  T  L  K  N  K  E  G  E  T  P  L  Q  C  A  S         p.980

          .         .         .         .         .         .       g.199147
 CTCAACTCTCAGGTGTGGAGCGCTCTGCAGATGAGCAAGGCTCTGCAGGACTCGGCCCCC       c.3000
 L  N  S  Q  V  W  S  A  L  Q  M  S  K  A  L  Q  D  S  A  P         p.1000

          .         .         .      | 21  .         .         .    g.199419
 GACAGGCCCAGCCCCGTGGAGAGGATAGTGAGCAG | GGACATCGCTCGAGGCTACGAGCGC    c.3060
 D  R  P  S  P  V  E  R  I  V  S  R  |  D  I  A  R  G  Y  E  R      p.1020

          .         .         .         .         .         .       g.199479
 ATCCCCATCCCCTGTGTCAACGCCGTGGACAGCGAGCCATGCCCCAGCAACTACAAGTAC       c.3120
 I  P  I  P  C  V  N  A  V  D  S  E  P  C  P  S  N  Y  K  Y         p.1040

          .         .         .         .         .         .       g.199539
 GTCTCTCAGAACTGCGTGACGTCCCCCATGAACATCGACAGAAATATCACTCATCTGCAG       c.3180
 V  S  Q  N  C  V  T  S  P  M  N  I  D  R  N  I  T  H  L  Q         p.1060

  | 22       .         .         .         .         .         .    g.200499
  | TACTGCGTGTGCATCGACGACTGCTCCTCCAGCAACTGCATGTGCGGCCAGCTCAGCATG    c.3240
  | Y  C  V  C  I  D  D  C  S  S  S  N  C  M  C  G  Q  L  S  M      p.1080

          .         | 23         .         .         .         .    g.201997
 CGCTGCTGGTACGACAAG | GATGGCCGGCTCCTGCCAGAGTTCAACATGGCGGAGCCTCCC    c.3300
 R  C  W  Y  D  K   | D  G  R  L  L  P  E  F  N  M  A  E  P  P      p.1100

          .         .         .         .         .         .       g.202057
 TTGATCTTCGAATGCAACCACGCGTGCTCCTGCTGGAGGAACTGCCGAAATCGCGTCGTA       c.3360
 L  I  F  E  C  N  H  A  C  S  C  W  R  N  C  R  N  R  V  V         p.1120

          .     | 24   .         .         .         .         .    g.203493
 CAGAATGGTCTCAG | GGCAAGGCTGCAGCTCTACCGGACGCGGGACATGGGCTGGGGCGTG    c.3420
 Q  N  G  L  R  |  A  R  L  Q  L  Y  R  T  R  D  M  G  W  G  V      p.1140

          .         .         .         .  | 25      .         .    g.204087
 CGGTCCCTGCAGGACATCCCACCAGGCACCTTTGTCTGCGA | GTATGTTGGGGAGCTGATT    c.3480
 R  S  L  Q  D  I  P  P  G  T  F  V  C  E  |  Y  V  G  E  L  I      p.1160

          .         .         .         .         .         .       g.204147
 TCAGACTCAGAAGCCGACGTTCGAGAGGAAGATTCTTACCTCTTTGATCTCGACAATAAG       c.3540
 S  D  S  E  A  D  V  R  E  E  D  S  Y  L  F  D  L  D  N  K         p.1180

  | 26       .         .         .         .         .         .    g.220417
  | GACGGGGAGGTTTACTGCATCGACGCGCGGTTCTACGGGAACGTCAGCCGGTTCATCAAC    c.3600
  | D  G  E  V  Y  C  I  D  A  R  F  Y  G  N  V  S  R  F  I  N      p.1200

          .         .         .         .         .         .       g.220477
 CACCACTGCGAGCCCAACCTGGTGCCCGTGCGCGTGTTCATGGCCCACCAGGACCTGCGG       c.3660
 H  H  C  E  P  N  L  V  P  V  R  V  F  M  A  H  Q  D  L  R         p.1220

          .         .         .         .         .       | 27 .    g.220785
 TTCCCCCGGATCGCCTTCTTCAGCACCCGCCTGATCGAGGCCGGCGAGCAGCTCGG | GTTT    c.3720
 F  P  R  I  A  F  F  S  T  R  L  I  E  A  G  E  Q  L  G  |  F      p.1240

          .         .         .         .         .         .       g.220845
 GACTATGGAGAGCGCTTCTGGGACATCAAAGGCAAGCTCTTCAGCTGCCGCTGCGGCTCC       c.3780
 D  Y  G  E  R  F  W  D  I  K  G  K  L  F  S  C  R  C  G  S         p.1260

          .         .         .         .         .         .       g.220905
 CCCAAGTGCCGGCACTCGAGCGCGGCCCTGGCCCAGCGTCAGGCCAGCGCGGCCCAGGAG       c.3840
 P  K  C  R  H  S  S  A  A  L  A  Q  R  Q  A  S  A  A  Q  E         p.1280

          .         .         .         .         .                 g.220962
 GCCCAGGAGGACGGCTTGCCCGACACCAGCTCCGCGGCTGCCGCCGACCCCCTATGA          c.3897
 A  Q  E  D  G  L  P  D  T  S  S  A  A  A  A  D  P  L  X            p.1298

          .         .         .         .         .         .       g.221022
 gacgccgccggccagcggggcgctcgggagccagggaccgccgcgtcgccgattagagga       c.*60

          .         .         .         .         .         .       g.221082
 cgaggaggagagattccgcacgcaaccgaaagggtccttcggggctgcgccgccggcttc       c.*120

          .         .         .         .         .         .       g.221142
 ctggaggggtcggaggtgaggctgcagcccctgcgggcgggtgtggatgcctcccagcca       c.*180

          .         .         .         .         .         .       g.221202
 ccttcccagacctgcggcctcaccgcgggcccagtgcccaggctggagcgcacactttgg       c.*240

          .         .         .         .         .         .       g.221262
 tccgcgcgccagagacgctgggagtccgcactggcatcaccttctgagtttctgatgctg       c.*300

          .         .         .         .         .         .       g.221322
 atttgtcgttgcgaagtttctcgtttcttcctctgacctccgaggtccccgctgcaccac       c.*360

          .         .         .         .         .         .       g.221382
 ggggttgctctgttctcctgtccggcccagactcttctgtgtggcgccgccgaagccacc       c.*420

          .         .         .         .         .         .       g.221442
 gttagcgcgagctgctccgttcgccctgcccacggcctgcgtggctggggccgagtccca       c.*480

          .         .         .         .         .         .       g.221502
 ggggccgcacggagggcacagtctcctgtcaggctcggagaggtcaggagaccgacccca       c.*540

          .         .         .         .         .         .       g.221562
 ccactaactttggagaaaatgtgggtttgctttttaaaggaatcctatatctagtcctat       c.*600

          .         .         .         .         .         .       g.221622
 atatcaaacctctaactgacgtttcttttcgaggaagtggcttggtgggtgcagcccccg       c.*660

          .         .         .         .         .         .       g.221682
 ccggttccgttgacgctggcaccttctgttgattttttaagccacatgctatgatgaata       c.*720

          .         .         .         .         .         .       g.221742
 aactgatttattttctaccattactgaacattaggacaaacacaaaataaaaaacaaaac       c.*780

          .         .         .         .         .         .       g.221802
 acagacaacggtgctgattctggtgtggtttctactcaccacgtgaaataaactatcaac       c.*840

          .         .         .         .         .         .       g.221862
 tgtataaagagaacaaagtgattttagaataaaatgcaggaaaaacttttttaaagatgt       c.*900

          .         .         .         .         .         .       g.221922
 tagtcttgtagcgtgaataaatttgccatcaccttttgtgtggtggcctggcaggtcata       c.*960

          .         .         .         .         .         .       g.221982
 tacttttttttggcatatacctttttaaagactgtaattagtgcagtaacagtggggttt       c.*1020

          .         .         .         .         .         .       g.222042
 tttttgtgcaactcttctaaaaacattcataatgcagtcatgtttatttttttctgttaa       c.*1080

          .         .         .         .         .         .       g.222102
 aatgtttttgacagttttaagagcagtcttttggctctgaccatttcttgttctgtttcc       c.*1140

          .         .         .                                     g.222136
 aatgaaatcaataaaaaaaaagaagtactttaaa                                 c.*1174

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Euchromatic histone-lysine N-methyltransferase 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center