eukaryotic translation initiation factor 5A (EIF5A) - coding DNA reference sequence

(used for variant description)

(last modified October 30, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_001143760.1 in the EIF5A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering EIF5A transcript NM_001143760.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5048
             accacactagcgcgctagaagagtggggcggaaagacatctcccgcgc       c.-1

          .         .         .         .         .         .       g.5108
 ATGTGTGGAACTGGGGGGACTGATTCCAAGACAAGGCGCCCACCCCACAGAGCAAGTTTT       c.60
 M  C  G  T  G  G  T  D  S  K  T  R  R  P  P  H  R  A  S  F         p.20

           | 02        .         .         .         .         .    g.7667
 CTGAAACGT | TTGGAATCGAAGCCTCTTAAAATGGCAGATGACTTGGACTTCGAGACAGGA    c.120
 L  K  R   | L  E  S  K  P  L  K  M  A  D  D  L  D  F  E  T  G      p.40

          .         .         .         .         .         .       g.7727
 GATGCAGGGGCCTCAGCCACCTTCCCAATGCAGTGCTCAGCATTACGTAAGAATGGCTTT       c.180
 D  A  G  A  S  A  T  F  P  M  Q  C  S  A  L  R  K  N  G  F         p.60

          .         .         .         .         .         .       g.7787
 GTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCGAAGACTGGCAAG       c.240
 V  V  L  K  G  R  P  C  K  I  V  E  M  S  T  S  K  T  G  K         p.80

          .      | 03  .         .         .         .         .    g.9064
 CACGGCCACGCCAAG | GTCCATCTGGTTGGTATTGACATCTTTACTGGGAAGAAATATGAA    c.300
 H  G  H  A  K   | V  H  L  V  G  I  D  I  F  T  G  K  K  Y  E      p.100

          .         .         .         .         .         .       g.9124
 GATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAAAGGAATGACTTCCAG       c.360
 D  I  C  P  S  T  H  N  M  D  V  P  N  I  K  R  N  D  F  Q         p.120

  | 04       .         .         .         .         .         .    g.9411
  | CTGATTGGCATCCAGGATGGGTACCTATCACTGCTCCAGGACAGCGGGGAGGTACGAGAG    c.420
  | L  I  G  I  Q  D  G  Y  L  S  L  L  Q  D  S  G  E  V  R  E      p.140

          .         .         .         .         .         .       g.9471
 GACCTTCGTCTCCCTGAGGGAGACCTTGGCAAGGAGATTGAGCAGAAGTACGACTGTGGA       c.480
 D  L  R  L  P  E  G  D  L  G  K  E  I  E  Q  K  Y  D  C  G         p.160

          .   | 05     .         .         .         .         .    g.9627
 GAAGAGATCCTG | ATCACGGTGCTGTCTGCCATGACAGAGGAGGCAGCTGTTGCAATCAAG    c.540
 E  E  I  L   | I  T  V  L  S  A  M  T  E  E  A  A  V  A  I  K      p.180

          .                                                     g.9642
 GCCATGGCAAAATAA |                                                 c.556
 A  M  A  K  X                                                   p.184

          .  | 06      .         .         .         .         .    g.9872
 ctggctcccag | ggtggcggtggtggcagcagtgatcctctgaacctgcagaggccccctc    c.*60

          .         .         .         .         .         .       g.9932
 cccgagcctggcctggctctggcccggtcctaagctggactcctcctacacaatttattt       c.*120

          .         .         .         .         .         .       g.9992
 gacgttttattttggttttccccaccccctcaatctgtcggggagcccctgcccttcacc       c.*180

          .         .         .         .         .         .       g.10052
 tagctcccttggccaggagcgagcgaagctgtggccttggtgaagctgccctcctcttct       c.*240

          .         .         .         .         .         .       g.10112
 cccctcacactacagccctggtgggggagaagggggtgggtgctgcttgtggtttagtct       c.*300

          .         .         .         .         .         .       g.10172
 tttttttttttttttttttaattcaatctggaatcagaaagcggtggattctggcaaatg       c.*360

          .         .         .         .         .         .       g.10232
 gtccttgtgccctccccactcatccctggtctggtcccctgttgcctatagccctttacc       c.*420

          .         .         .         .         .         .       g.10292
 ctgagcaccaccccaacagactggggaccagccccctcgcctgcctgtgtctctccccaa       c.*480

          .         .         .         .         .         .       g.10352
 acccctttagatggggagggaagaggaggagaggggaggggacctgccccctcctcaggc       c.*540

          .         .         .         .         .         .       g.10412
 atctgggagggccctgcccccatgggctttacccttccctgcgggctctctccccgacac       c.*600

          .         .         .         .         .                 g.10465
 atttgttaaaatcaaacctgaataaaactacaagtttaatatgaagcccccaa              c.*653

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Eukaryotic translation initiation factor 5A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.