excision repair cross-complementing rodent repair deficiency, complementation group 4 (ERCC4) - coding DNA reference sequence

(used for variant description)

(last modified October 3, 2014)


This file was created to facilitate the description of sequence variants in the ERCC4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011442.1 (identical to LRG_463), covering ERCC4 transcript NM_005236.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5009
                                                    agagcttcc       c.-1

          .         .         .         .         .         .       g.5069
 ATGGAGTCAGGGCAGCCGGCTCGACGGATTGCCATGGCGCCGCTGCTGGAGTACGAGCGA       c.60
 M  E  S  G  Q  P  A  R  R  I  A  M  A  P  L  L  E  Y  E  R         p.20

          .         .         .         .         .         .       g.5129
 CAGCTGGTGCTGGAACTGCTCGACACTGACGGGCTAGTAGTGTGCGCCCGCGGGCTCGGC       c.120
 Q  L  V  L  E  L  L  D  T  D  G  L  V  V  C  A  R  G  L  G         p.40

          .         .         .         .         .         .       g.5189
 GCGGACCGGCTCCTCTACCACTTTCTCCAGCTGCACTGCCACCCAGCCTGCCTGGTGCTG       c.180
 A  D  R  L  L  Y  H  F  L  Q  L  H  C  H  P  A  C  L  V  L         p.60

          .         .        | 02.         .         .         .    g.6907
 GTGCTCAACACGCAGCCGGCCGAGGAG | GAGTATTTTATCAATCAGCTGAAGATAGAAGGA    c.240
 V  L  N  T  Q  P  A  E  E   | E  Y  F  I  N  Q  L  K  I  E  G      p.80

          .         .         .         .         .         .       g.6967
 GTTGAACACCTCCCTCGCCGTGTAACAAATGAAATCACAAGCAACAGTCGCTATGAAGTT       c.300
 V  E  H  L  P  R  R  V  T  N  E  I  T  S  N  S  R  Y  E  V         p.100

          .         .         .         .         .         .       g.7027
 TACACACAAGGTGGTGTTATATTTGCGACAAGTAGGATACTTGTGGTTGACTTCTTGACT       c.360
 Y  T  Q  G  G  V  I  F  A  T  S  R  I  L  V  V  D  F  L  T         p.120

          .         .         | 03         .         .         .    g.11436
 GATAGAATACCTTCAGATTTAATTACTG | GCATCTTGGTGTATAGAGCCCACAGAATAATC    c.420
 D  R  I  P  S  D  L  I  T  G |   I  L  V  Y  R  A  H  R  I  I      p.140

          .         .         .         .         .         .       g.11496
 GAGTCTTGTCAAGAAGCATTCATCTTGCGCCTCTTTCGCCAGAAAAACAAACGTGGTTTT       c.480
 E  S  C  Q  E  A  F  I  L  R  L  F  R  Q  K  N  K  R  G  F         p.160

          .         .         .         .         .         .       g.11556
 ATTAAAGCTTTCACAGACAATGCTGTTGCCTTTGATACTGGTTTTTGTCATGTGGAAAGA       c.540
 I  K  A  F  T  D  N  A  V  A  F  D  T  G  F  C  H  V  E  R         p.180

          .         .         .         .     | 04   .         .    g.12887
 GTGATGAGAAATCTTTTTGTGAGGAAACTGTATCTGTGGCCAAG | GTTCCATGTAGCAGTA    c.600
 V  M  R  N  L  F  V  R  K  L  Y  L  W  P  R  |  F  H  V  A  V      p.200

          .         .         .         .         .         .       g.12947
 AACTCATTTTTAGAACAGCACAAACCTGAAGTTGTAGAAATCCATGTTTCTATGACACCT       c.660
 N  S  F  L  E  Q  H  K  P  E  V  V  E  I  H  V  S  M  T  P         p.220

          .         .         .         .         .         .       g.13007
 ACCATGCTTGCTATACAGACTGCTATACTGGACATTTTAAATGCATGTCTAAAGGAACTA       c.720
 T  M  L  A  I  Q  T  A  I  L  D  I  L  N  A  C  L  K  E  L         p.240

          .         .         .         .         .         .       g.13067
 AAATGCCATAACCCATCGCTTGAAGTGGAAGATTTATCTTTAGAAAATGCTATTGGAAAA       c.780
 K  C  H  N  P  S  L  E  V  E  D  L  S  L  E  N  A  I  G  K         p.260

          .   | 05     .         .         .         .         .    g.15601
 CCTTTTGACAAG | ACAATCCGCCATTATCTGGATCCTTTGTGGCACCAGCTTGGAGCCAAG    c.840
 P  F  D  K   | T  I  R  H  Y  L  D  P  L  W  H  Q  L  G  A  K      p.280

          .         .         .         .         .         .       g.15661
 ACTAAATCCTTAGTTCAGGATTTGAAGATATTACGAACTTTGCTGCAGTATCTCTCTCAG       c.900
 T  K  S  L  V  Q  D  L  K  I  L  R  T  L  L  Q  Y  L  S  Q         p.300

          .         .         .         .         .         .       g.15721
 TATGATTGTGTCACATTTCTTAATCTTCTGGAATCTCTGAGAGCAACGGAAAAAGCTTTT       c.960
 Y  D  C  V  T  F  L  N  L  L  E  S  L  R  A  T  E  K  A  F         p.320

          .    | 06    .         .         .         .         .    g.17047
 GGTCAGAATTCAG | GTTGGCTGTTTCTTGACTCCAGCACCTCGATGTTTATAAATGCTCGA    c.1020
 G  Q  N  S  G |   W  L  F  L  D  S  S  T  S  M  F  I  N  A  R      p.340

          .         .         .         .         .         .       g.17107
 GCAAGGGTTTATCATCTTCCAGATGCCAAAATGAGTAAAAAAGAAAAAATATCTGAAAAA       c.1080
 A  R  V  Y  H  L  P  D  A  K  M  S  K  K  E  K  I  S  E  K         p.360

          .         .   | 07     .         .         .         .    g.19073
 ATGGAAATTAAAGAAGGGGAAG | AAACAAAAAAGGAACTGGTCCTAGAAAGCAACCCAAAG    c.1140
 M  E  I  K  E  G  E  E |   T  K  K  E  L  V  L  E  S  N  P  K      p.380

          .         .         .         .         .         .       g.19133
 TGGGAGGCACTGACTGAAGTATTAAAAGAAATTGAGGCAGAAAATAAGGAGAGTGAAGCT       c.1200
 W  E  A  L  T  E  V  L  K  E  I  E  A  E  N  K  E  S  E  A         p.400

          .    | 08    .         .         .         .         .    g.20036
 CTTGGTGGTCCAG | GTCAAGTACTGATTTGTGCAAGTGATGACCGAACATGTTCCCAGCTG    c.1260
 L  G  G  P  G |   Q  V  L  I  C  A  S  D  D  R  T  C  S  Q  L      p.420

          .         .         .         .         .         .       g.20096
 AGAGACTATATCACTCTTGGAGCGGAGGCCTTCTTATTGAGGCTCTACAGGAAAACCTTT       c.1320
 R  D  Y  I  T  L  G  A  E  A  F  L  L  R  L  Y  R  K  T  F         p.440

          .         .         .         .         .         .       g.20156
 GAGAAGGATAGCAAAGCTGAAGAAGTCTGGATGAAATTTAGGAAGGAAGACAGTTCAAAG       c.1380
 E  K  D  S  K  A  E  E  V  W  M  K  F  R  K  E  D  S  S  K         p.460

          .         .         .         .         .         .       g.20216
 AGAATTAGGAAATCTCACAAAAGACCTAAAGACCCCCAAAACAAAGAACGGGCTTCTACC       c.1440
 R  I  R  K  S  H  K  R  P  K  D  P  Q  N  K  E  R  A  S  T         p.480

          .         .         .         .         .         .       g.20276
 AAAGAAAGAACCCTCAAAAAGAAAAAACGGAAGTTGACCTTAACTCAAATGGTAGGAAAA       c.1500
 K  E  R  T  L  K  K  K  K  R  K  L  T  L  T  Q  M  V  G  K         p.500

          .         .         .         .         .         .       g.20336
 CCTGAAGAACTGGAAGAGGAAGGAGATGTCGAGGAAGGATATCGTCGAGAAATAAGCAGT       c.1560
 P  E  E  L  E  E  E  G  D  V  E  E  G  Y  R  R  E  I  S  S         p.520

          .         .         .         .         .         .       g.20396
 AGCCCAGAAAGCTGCCCGGAAGAAATTAAGCATGAAGAATTTGATGTAAATTTGTCATCG       c.1620
 S  P  E  S  C  P  E  E  I  K  H  E  E  F  D  V  N  L  S  S         p.540

          .         .         .         .         .         .       g.20456
 GATGCTGCTTTCGGAATCCTGAAAGAACCCCTCACTATCATCCATCCGCTTCTGGGTTGC       c.1680
 D  A  A  F  G  I  L  K  E  P  L  T  I  I  H  P  L  L  G  C         p.560

          .         .         .         .         .         .       g.20516
 AGCGACCCCTATGCTCTGACAAGGGTACTACATGAAGTGGAGCCAAGATACGTGGTTCTT       c.1740
 S  D  P  Y  A  L  T  R  V  L  H  E  V  E  P  R  Y  V  V  L         p.580

          .         .         .         .         .         .       g.20576
 TATGACGCAGAGCTAACCTTTGTTCGGCAGCTTGAAATTTACAGGGCGAGTAGGCCTGGG       c.1800
 Y  D  A  E  L  T  F  V  R  Q  L  E  I  Y  R  A  S  R  P  G         p.600

          .  | 09      .         .         .         .         .    g.22658
 AAACCTCTGAG | GGTTTACTTTCTTATATACGGAGGTTCAACTGAGGAACAACGCTATCTC    c.1860
 K  P  L  R  |  V  Y  F  L  I  Y  G  G  S  T  E  E  Q  R  Y  L      p.620

          .         .         .         .     | 10   .         .    g.29582
 ACTGCTTTGCGGAAAGAAAAGGAAGCTTTTGAAAAACTCATAAG | GGAAAAAGCAAGCATG    c.1920
 T  A  L  R  K  E  K  E  A  F  E  K  L  I  R  |  E  K  A  S  M      p.640

          .         .         .         .         .         .       g.29642
 GTTGTCCCTGAAGAAAGAGAAGGCAGAGATGAAACAAACTTAGACCTAGTAAGAGGCACA       c.1980
 V  V  P  E  E  R  E  G  R  D  E  T  N  L  D  L  V  R  G  T         p.660

          .         .         .        | 11.         .         .    g.32480
 GCATCTGCAGATGTTTCCACTGACACTCGGAAAGCCG | GTGGCCAGGAACAGAATGGTACA    c.2040
 A  S  A  D  V  S  T  D  T  R  K  A  G |   G  Q  E  Q  N  G  T      p.680

          .         .         .         .         .         .       g.32540
 CAGCAAAGCATAGTTGTGGATATGCGTGAATTTCGAAGTGAGCTTCCATCTCTGATCCAT       c.2100
 Q  Q  S  I  V  V  D  M  R  E  F  R  S  E  L  P  S  L  I  H         p.700

          .         .         .         .         .         .       g.32600
 CGTCGGGGCATTGACATTGAACCCGTGACTTTAGAGGTTGGAGATTACATCCTCACTCCA       c.2160
 R  R  G  I  D  I  E  P  V  T  L  E  V  G  D  Y  I  L  T  P         p.720

          .         .         .         .         .         .       g.32660
 GAAATGTGCGTGGAGCGCAAGAGTATCAGTGATTTAATCGGCTCTTTAAATAACGGCCGC       c.2220
 E  M  C  V  E  R  K  S  I  S  D  L  I  G  S  L  N  N  G  R         p.740

          .         .         .         .         .         .       g.32720
 CTCTACAGCCAGTGCATCTCCATGTCCCGCTACTACAAGCGTCCCGTGCTTCTGATTGAG       c.2280
 L  Y  S  Q  C  I  S  M  S  R  Y  Y  K  R  P  V  L  L  I  E         p.760

          .         .         .         .         .         .       g.32780
 TTTGACCCTAGCAAGCCTTTCTCTCTCACTTCCCGAGGTGCCTTGTTTCAGGAGATCTCC       c.2340
 F  D  P  S  K  P  F  S  L  T  S  R  G  A  L  F  Q  E  I  S         p.780

          .         .         .         .         .         .       g.32840
 AGCAATGACATTAGTTCCAAACTCACTCTTCTTACACTTCACTTCCCCAGACTACGGATT       c.2400
 S  N  D  I  S  S  K  L  T  L  L  T  L  H  F  P  R  L  R  I         p.800

          .         .         .         .         .         .       g.32900
 CTCTGGTGCCCCTCTCCTCATGCAACGGCGGAGTTGTTTGAGGAGCTGAAACAAAGCAAG       c.2460
 L  W  C  P  S  P  H  A  T  A  E  L  F  E  E  L  K  Q  S  K         p.820

          .         .         .         .         .         .       g.32960
 CCACAGCCTGATGCGGCGACAGCACTGGCCATTACAGCAGATTCTGAAACCCTTCCCGAG       c.2520
 P  Q  P  D  A  A  T  A  L  A  I  T  A  D  S  E  T  L  P  E         p.840

          .         .         .         .         .         .       g.33020
 TCAGAGAAGTATAATCCTGGTCCCCAAGACTTCTTGTTAAAAATGCCAGGGGTGAATGCC       c.2580
 S  E  K  Y  N  P  G  P  Q  D  F  L  L  K  M  P  G  V  N  A         p.860

          .         .         .         .         .         .       g.33080
 AAAAACTGCCGCTCCTTGATGCACCACGTTAAGAACATCGCAGAATTAGCAGCCCTGTCA       c.2640
 K  N  C  R  S  L  M  H  H  V  K  N  I  A  E  L  A  A  L  S         p.880

          .         .         .         .         .         .       g.33140
 CAAGACGAGCTCACGAGTATTCTGGGGAATGCTGCAAATGCCAAACAGCTTTATGATTTC       c.2700
 Q  D  E  L  T  S  I  L  G  N  A  A  N  A  K  Q  L  Y  D  F         p.900

          .         .         .         .         .                 g.33191
 ATTCACACCTCTTTTGCAGAAGTCGTATCAAAAGGAAAAGGGAAAAAGTGA                c.2751
 I  H  T  S  F  A  E  V  V  S  K  G  K  G  K  K  X                  p.916

          .         .         .         .         .         .       g.33251
 acagtgatggctgttttcttatcccatgcctgtacttttcagcggctccttgccagacat       c.*60

          .         .         .         .         .         .       g.33311
 cataggtcattattaattattggtttgctatttcattcttttccaatgctcttaatgatt       c.*120

          .         .         .         .         .         .       g.33371
 gtacggtggaccagaagccaggattcctctctgaactctgcagttaggcatcacttgaac       c.*180

          .         .         .         .         .         .       g.33431
 ttgcctgtgcctgctctttttcctccctgcaccgtctatgccgggcttagcatgtttctt       c.*240

          .         .         .         .         .         .       g.33491
 tttaaatgaggtttgtcaggatcaggtaaagttcctacaagtgattacagaaggtagaaa       c.*300

          .         .         .         .         .         .       g.33551
 ctttacctgatcctaacagatctcatttagaaaggaatatgctaagcctggcatggacgg       c.*360

          .         .         .         .         .         .       g.33611
 tgcagggagggaaaagagcaggcacaagaaagctaccatttttaacagtccttgttatct       c.*420

          .         .         .         .         .         .       g.33671
 agtgcaacataaataacagtcttaattgcacttatacccatgtcctgtggctctccaaat       c.*480

          .         .         .         .         .         .       g.33731
 ctggtctttgctgttgtgtctgctggacgcttgaactgatgtttgtgtaggaaatcatgt       c.*540

          .         .         .         .         .         .       g.33791
 tctgaccctttgtctacaaaggagccttctggaacactgagaagaaacatctctttgcca       c.*600

          .         .         .         .         .         .       g.33851
 ttcctgaccagttctctctaccacattttcttcagctccatacttctgcctgtctgctct       c.*660

          .         .         .         .         .         .       g.33911
 aaggaaatttcatggagccttcctactactaattcaagacagtctcctcaaaaactggtt       c.*720

          .         .         .         .         .         .       g.33971
 gactagtcttctaatgaccctaacatatgtagcatatactataatttcattgttccaaat       c.*780

          .         .         .         .         .         .       g.34031
 tagtatttttaaagcaaaatgaattacctgtttgcaaaagttaatgatgaaggagctctt       c.*840

          .         .         .         .         .         .       g.34091
 agaattctcaatttttgcacatattcagtctcctaatatcagagatccctaagtccagct       c.*900

          .         .         .         .         .         .       g.34151
 ggctagttacagagttttttcagacttcctcgtttctcagctcttatatcctaagacacc       c.*960

          .         .         .         .         .         .       g.34211
 agcatcatatcctctagaaatacaacctaattggcagtgagccgagatcgcaccactgca       c.*1020

          .         .         .         .         .         .       g.34271
 cccctgcctgggcgacagagtgagactttgtctctattacaaaaagaaaagaaaagaaat       c.*1080

          .         .         .         .         .         .       g.34331
 acaacctaagctcacctgcctgtgattcctcatttctcaccatcctgtgccagggtggct       c.*1140

          .         .         .         .         .         .       g.34391
 acttctctctgtgaggactcaaatacaagccaatgagtggcccactaagcttttaagatt       c.*1200

          .         .         .         .         .         .       g.34451
 tgattttcctgccttgagataaaaaggagtgtaggtaaatgaaagatcaatgtatggaat       c.*1260

          .         .         .         .         .         .       g.34511
 atataaaaatacgaaagaaatatatacgtttaaaaatccataaagaaaaaaatctcattc       c.*1320

          .         .         .         .         .         .       g.34571
 taaacctgattaagttggctttttacgtaagtgtacaaataggatattcacagcatcttt       c.*1380

          .         .         .         .         .         .       g.34631
 gtgcagtttttaaacttttatatttaaacattattaagttggcttttgttcacatgttga       c.*1440

          .         .         .         .         .         .       g.34691
 gtaatgggtagtaaattttctacctcaggagctgatatagacatcagttctgctagccat       c.*1500

          .         .         .         .         .         .       g.34751
 atcacatattttaatgtttcatcaacatcagctgtttttttgtttgctacactatttgaa       c.*1560

          .         .         .         .         .         .       g.34811
 ctaatagacagtggatcatgtaacacaaaattgtcttcaactttaacaaaattgtcattg       c.*1620

          .         .         .         .         .         .       g.34871
 ttatttttttttgagacagagtctccctctgttgcccaggctggagtgcagtggcgcaat       c.*1680

          .         .         .         .         .         .       g.34931
 ctcggctcactgcaacctcgcctgctgggttcaagcagttctcccacctcagcctcccaa       c.*1740

          .         .         .         .         .         .       g.34991
 gtagctgggattataggtgtgcaccaccagacccggctaatttttgtatttttagtagag       c.*1800

          .         .         .         .         .         .       g.35051
 acggggtttcaccatgttggccaggctggtctcaaactactgacctcaggtgatccaccc       c.*1860

          .         .         .         .         .         .       g.35111
 accttggcctcccaaagtgctgagataacaggcgtgagccaccgcacccacccaacaaaa       c.*1920

          .         .         .         .         .         .       g.35171
 ttatttttaactgtcgtttctgaactgaacctctcacattggcatcttgatttattggta       c.*1980

          .         .         .         .         .         .       g.35231
 cttaacagtatatatggattttgaactctacacaagggtataaccagaatgaattgaggg       c.*2040

          .         .         .         .         .         .       g.35291
 gtatcaagaaccagattggttacagtagaactctgtaagatgatgtggagagtaaggaaa       c.*2100

          .         .         .         .         .         .       g.35351
 aggagaagaaataaaaattagtttaagatggaataaagatttgggctgctaattttttcc       c.*2160

          .         .         .         .         .         .       g.35411
 caggattcaaaatatacccgctagaatggaaaacaaaaatttgaatgattacaacattat       c.*2220

          .         .         .         .         .         .       g.35471
 cgttaacattcaattttgtatttattgttttattgaatatagttcagagtatattaaaat       c.*2280

          .         .         .         .         .         .       g.35531
 agacctaccacttcaaatgataatgattattataatgtctcttcaccctattctagcact       c.*2340

          .         .         .         .         .         .       g.35591
 tctgcttgcagtatgtggtttctatttttttcctcttgtataattccacttgcttttaat       c.*2400

          .         .         .         .         .         .       g.35651
 tgttgtttcattatataaaaggaacatcttcccatagcatattctatgaaaggggtttca       c.*2460

          .         .         .         .         .         .       g.35711
 ttccaagttgagttttcaaaaaaaaggtcttcctaaagctaccattttcaaccgtccttg       c.*2520

          .         .         .         .         .         .       g.35771
 ttatctagtacaacataaataacagtcttaaaaattgcactaataccagtgcccccctgg       c.*2580

          .         .         .         .         .         .       g.35831
 ctctccaaatctgttctttgctcttgtatctgctggacgcttgaagacaggtgcactgtc       c.*2640

          .         .         .         .         .         .       g.35891
 tcgtatgtatttgaattatgaacagtaatttctaatgaattctaaaatggtcattgtaag       c.*2700

          .         .         .         .         .         .       g.35951
 tgaaagcctctcgctaccacttcctcttccaactacataaatatatttcaatgtatttcc       c.*2760

          .         .         .         .         .         .       g.36011
 agttttggaaagttttcaatacatacatcaagtgtttacttagatttttataaaaatttt       c.*2820

          .         .         .         .         .         .       g.36071
 ttttacaatctaataatctttggtaaaggaactagagatgcatgcagttgcaaaattaat       c.*2880

          .         .         .         .         .         .       g.36131
 gtatttattttccagcataattttattaacttcactttttttctctctagtaaatatcca       c.*2940

          .         .         .         .         .         .       g.36191
 gtgtacttatgaactcatgtttggctcttttaaaaccttttctaaaagctagatcagcat       c.*3000

          .         .         .         .         .         .       g.36251
 ttttctattttacaagttttttgtataaaaaggtgaacatatgagatattgtgagaaatc       c.*3060

          .         .         .         .         .         .       g.36311
 attttaagtttcatttaaatcatggtgcctcttttgatactttcttaaaattgtgcaaga       c.*3120

          .         .         .         .         .         .       g.36371
 agaaatcatttttagtagtggtcataaatattatccttttggcagtaagctattactaat       c.*3180

          .         .         .         .         .         .       g.36431
 tcagcctgaagctcggtagacaatatgtctacatgtgtttgagtacatcctggatacagt       c.*3240

          .         .         .         .         .         .       g.36491
 ttcccagctcatgagggactgaaaatagtcttattcatcaacccactaggatgtgaaggg       c.*3300

          .         .         .         .         .         .       g.36551
 ttaagtctagatttggtcgcattgaaaccccacaatatagaattaataaatggccttcag       c.*3360

          .         .         .         .         .         .       g.36611
 taggaaaacctacactaaagcaaatccgaagaagtggggcagggggaaagaggcattact       c.*3420

          .         .         .         .         .         .       g.36671
 ggtctttccttttgttttgcaagcataatttgattttcctttggctcagaaaactcattt       c.*3480

          .         .         .         .         .         .       g.36731
 ggggaaattctcttttgtgttcagtttaacctagaaaggtcctcttgaaaaaccaacatt       c.*3540

          .         .         .         .         .         .       g.36791
 ttaggaaagttcttttttcaggatggagtatattaaaattaagccaggctttgacgtgaa       c.*3600

          .         .         .         .         .         .       g.36851
 ttatcacttttctttattattttgttttctattttggtttatagctatttctggttcagt       c.*3660

          .         .         .         .         .         .       g.36911
 tctgaacttcagcacttaatcatccttatcaaccaggcttttggtagcctaaaccgctat       c.*3720

          .         .         .         .         .         .       g.36971
 gctgttgtttttttaatttaaagatgtataagccaaaatttggatgggagtgagacataa       c.*3780

          .         .         .         .         .         .       g.37031
 ctgatttatatgaattttaacagagttgtatttgtgtgtgtttaataaaatatatattta       c.*3840

          .         .         .         .         .         .       g.37091
 ttcagtactttcctcagtattttatgggcaaagtaaaaataacaatgcatagtgaaaggg       c.*3900

          .         .         .         .         .         .       g.37151
 catatattaccagcagtaataattcaaaatcctgaaaatgtttcattttttttgtttttg       c.*3960

          .         .         .         .                           g.37192
 ttatgcagaataaacaaggcagaaatgctctttgaaccact                          c.*4001

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Excision repair cross-complementing rodent repair deficiency, complementation group 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 11c
©2004-2014 Leiden University Medical Center