eyes absent homolog 1 (Drosophila) (EYA1) - coding DNA reference sequence

(used for variant description)

(last modified July 23, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_000503.4 in the EYA1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011735.2, covering EYA1 transcript NM_000503.4.

Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5040
                     aaaccaataaggttaggacaagagaatagctgtggtttgc       c.-601

 .         .         .         .         .         .                g.5100
 gttgcaaaaaccaaaaaaaaaaaaaaaaaaaaaaaaagaaagccccgaggctccatgggc       c.-541

 .         .         .         .         .         .                g.5160
 agacctacaaggctgcgcaaacaaatcgagggatgagattctgctgtttctttgtctagg       c.-481

 .         .         .         .         .         .                g.5220
 gttctcagatgctatctgccgctgctgtttggtggggaaggagcgctgggcgcaaagctg       c.-421

 .         .         .         .         .         .                g.5280
 ttaccaaacagaacggtgggagctgatggctccgagtttggggcgaggtagaaactctcc       c.-361

 .         .         .         .         .         .                g.5340
 agtgccacttccgactttaagccttcctgttgccgtccactgtggcgggtttcttcctgg       c.-301

 .         .         .         .         .         .                g.5400
 ggaacacgttttcgctcagtcgctcggcagcccgagcctgcggcagcggccaggcgcctg       c.-241

 .         .         .         .         .         .                g.5460
 ccccctgcgccgagctttcccctgcagaggcgctccactcccagaagcgccgcggctgca       c.-181

 .         .         .         .         .         .                g.5520
 ccagagcgcctgagagcccccgcgcgtacccatccaggagcaaaactatgtcaggaatgg       c.-121

 .         .         .         .         .         .                g.5580
 aggtttgctaacccagaaaattcgaaggaacacattaaactggtggatgcagcagatgta       c.-61

 .      | 02  .         .         .         .         .      | 03   g.12327
 agcgct | gtgcaaacatctcaagccagttcagatgttgctgtttcctcaagttgcag | gtct c.-1

          .         .         .         .         .         .       g.12387
 M  E  M  Q  D  L  T  S  P  H  S  R  L  S  G  S  S  E  S  P         p.20

          .         .         .         .         .         .       g.12447
 S  G  P  K  L  G  N  S  H  I  N  S  N  S  M  T  P  N  G  T         p.40

      | 04   .         .         .         .         .         .    g.33114
 E  V |   K  T  E  P  M  S  S  S  E  T  A  S  T  T  A  D  G  S      p.60

          .         .   | 05     .         .         .         .    g.45002
 L  N  N  F  S  G  S  A |   I  G  S  S  S  F  S  P  R  P  T  H      p.80

          .         .         .   | 06     .         .         .    g.45381
 Q  F  S  P  P  Q  I  Y  P  S  N  |  R  P  Y  P  H  I  L  P  T      p.100

          .         .         .         .         .         .       g.45441
 P  S  S  Q  T  M  A  A  Y  G  Q  T  Q  F  T  T  G  M  Q  Q         p.120

          .         .         .         .         .         | 07    g.49545
 A  T  A  Y  A  T  Y  P  Q  P  G  Q  P  Y  G  I  S  S  Y  G |       p.140

          .         .         .         .         .         .       g.49605
 A  L  W  A  G  I  K  T  E  G  G  L  S  Q  S  Q  S  P  G  Q         p.160

          .         .         .         .         .         .       g.49665
 T  G  F  L  S  Y  G  T  S  F  S  T  P  Q  P  G  Q  A  P  Y         p.180

          .       | 08 .         .         .         .         .    g.67556
 S  Y  Q  M  Q  G |   S  S  F  T  T  S  S  G  I  Y  T  G  N  N      p.200

          .         .         .          | 09        .         .    g.68020
 S  L  T  N  S  S  G  F  N  S  S  Q  Q   | D  Y  P  S  Y  P  S      p.220

          .         .         .         .         .         .       g.68080
 F  G  Q  G  Q  Y  A  Q  Y  Y  N  S  S  P  Y  P  A  H  Y  M         p.240

          .         .         .         .         .         .       g.68140
 T  S  S  N  T  S  P  T  T  P  S  T  N  A  T  Y  Q  L  Q  E         p.260

          .         .         .         .       | 10 .         .    g.95349
 P  P  S  G  I  T  S  Q  A  V  T  D  P  T  A  E |   Y  S  T  I      p.280

          .         .         .         .         .         .       g.95409
 H  S  P  S  T  P  I  K  D  S  D  S  D  R  L  R  R  G  S  D         p.300

          .         .         .         .         .         .       g.95469
 G  K  S  R  G  R  G  R  R  N  N  N  P  S  P  P  P  D  S  D         p.320

        | 11 .         .         .         .         .         .    g.97463
 L  E   | R  V  F  I  W  D  L  D  E  T  I  I  V  F  H  S  L  L      p.340

          .         .         . | 12       .         .         .    g.122570
 T  G  S  Y  A  N  R  Y  G  R   | D  P  P  T  S  V  S  L  G  L      p.360

          .         .         .         .         .         .       g.122630
 R  M  E  E  M  I  F  N  L  A  D  T  H  L  F  F  N  D  L  E         p.380

  | 13       .         .         .         .         .          | 14 g.150381
  | E  C  D  Q  V  H  I  D  D  V  S  S  D  D  N  G  Q  D  L  S  |   p.400

          .         .         .         .         .         .       g.150441
 T  Y  N  F  G  T  D  G  F  P  A  A  A  T  S  A  N  L  C  L         p.420

          .         .         .         .         .         .       g.150501
 A  T  G  V  R  G  G  V  D  W  M  R  K  L  A  F  R  Y  R  R         p.440

          .         .         .         . | 15       .         .    g.151524
 V  K  E  I  Y  N  T  Y  K  N  N  V  G  G |   L  L  G  P  A  K      p.460

          .         .         .         .         .         .       g.151584
 R  E  A  W  L  Q  L  R  A  E  I  E  A  L  T  D  S  W  L  T         p.480

          .         .         .      | 16  .         .         .    g.151749
 L  A  L  K  A  L  S  L  I  H  S  R  |  T  N  C  V  N  I  L  V      p.500

          .         .         .         .         .         .       g.151809
 T  T  T  Q  L  I  P  A  L  A  K  V  L  L  Y  G  L  G  I  V         p.520

          .         .         .        | 17.         .         .    g.155999
 F  P  I  E  N  I  Y  S  A  T  K  I  G |   K  E  S  C  F  E  R      p.540

          .         .         .         .         .         .       g.156059
 I  I  Q  R  F  G  R  K  V  V  Y  V  V  I  G  D  G  V  E  E         p.560

          .         | 18         .         .         .         .    g.167854
 E  Q  G  A  K  K   | H  A  M  P  F  W  R  I  S  S  H  S  D  L      p.580

          .         .         .                                     g.167893
 M  A  L  H  H  A  L  E  L  E  Y  L  X                              p.592

          .         .         .         .         .         .       g.167953
 cagcgctcggcactttgacagcgcacagctgctctgtgaccagggacagatccagcaggc       c.*60

          .         .         .         .         .         .       g.168013
 cccagtctcgcatcagcgccggcctccagaacttagcaatttccgcctggtgatgcgcag       c.*120

          .         .         .         .         .         .       g.168073
 ttgctgtcagtcttgacctctgcctttgtggtgaatggaggaccacgtctatttcatcag       c.*180

          .         .         .         .         .         .       g.168133
 aacagctgttgactctagtactgtgaatccagtgaaaataagccatgagaatgttttagc       c.*240

          .         .         .         .         .         .       g.168193
 acagcgttatgtgtctgccacattaactacacggttcaaacctgtgaagaaaggacctgc       c.*300

          .         .         .         .         .         .       g.168253
 aaacgcttcagttgttagcattttcaatgtgatataaacagcttctccaatacagcaaac       c.*360

          .         .         .         .         .         .       g.168313
 ctaattgcacaacagagactgaaatgtgtttcctgaataccagtggaggaattttcttgt       c.*420

          .         .         .         .         .         .       g.168373
 aaagaaggtttactttttggtgtctcatacccagggtaatctgtacatctctacttattt       c.*480

          .         .         .         .         .         .       g.168433
 atgaacagactttttttaaaaagataaaaaaacagctttattgaggtataattcacccac       c.*540

          .         .         .         .         .         .       g.168493
 cagacttttttaaacatcaaataattgaagagacaatagcattagaaataagtgattaaa       c.*600

          .         .         .         .         .         .       g.168553
 ggcctctgcctcacaacatggcaagtacagtactttgaattttagcacattgcatagtag       c.*660

          .         .         .         .         .         .       g.168613
 ttttaagtatgtctaatttaaacgtataatatgtacatcactgagacaatcatgtacaga       c.*720

          .         .         .         .         .         .       g.168673
 aagaatttttggtgtaaatttgtaataatggataattcttttacatattgtttagggaaa       c.*780

          .         .         .         .         .         .       g.168733
 tgatattgaaaggtagcaatgcctggatagtgaagcatgaggcagcacgtgcacaaattc       c.*840

          .         .         .         .         .         .       g.168793
 atgtgccgtgccttatctgagttttcggtataaatatgtagataatggattttttttttt       c.*900

          .         .         .         .         .         .       g.168853
 tagataatgttgtcaagaccaaaagcatggatgtcaagtgtcagtaaggattttgttttc       c.*960

          .         .         .         .         .         .       g.168913
 taaaattttttcctgcatcagttcttctgagggccttgatgaaataacacagcagtttct       c.*1020

          .         .         .         .         .         .       g.168973
 taaacaatttgaaacaaaatgagctctcctaccacctcactttttcatttccacactaat       c.*1080

          .         .         .         .         .         .       g.169033
 gtattatatgtaactacttggaaaaaataattattcaaatgcttcttcccacaaagaata       c.*1140

          .         .         .         .         .         .       g.169093
 tagatgatagtagatatattttattaataaaatggttcatgaatcggagactaacaaagt       c.*1200

          .         .         .         .         .         .       g.169153
 tttcatgtgctcagaattattaattatcgtgtctgcattttctttcgataaaggaagaca       c.*1260

          .         .         .         .         .         .       g.169213
 cacgatgctaatccggaaatcagcaaactttgcattactccctatgtgcgtattttctct       c.*1320

          .         .         .         .         .         .       g.169273
 ttcttcctgtcaccctgaggaaggttcattgccattgtcatcaccatggaaacaacgttc       c.*1380

          .         .         .         .         .         .       g.169333
 ctctccacctgcattatgtactacatgacaggcatcaatctggggaaataataaaattat       c.*1440

          .         .         .         .         .         .       g.169393
 cacctttgtcagaccataagagtttctccaaaagtggtcagtttggctgggcaatatttt       c.*1500

          .         .         .         .         .         .       g.169453
 ctctcatctaacaaacacaatccattgtcatgaaattacccttaggatgagtcttcttta       c.*1560

          .         .         .         .         .         .       g.169513
 atcaatcatatattgggcgggaaaaacaccagctttgacccgaagtagttgaagagctac       c.*1620

          .         .         .         .         .         .       g.169573
 ttcattcttttctgaagttgtgtgttgctgctagaaatagtcatttgtgaattatccaaa       c.*1680

          .         .         .         .         .         .       g.169633
 ttgtttaaattcacaattgaattagttttttcttcctttttgcttgaagcaaacagttga       c.*1740

          .         .         .         .         .         .       g.169693
 caatttttaaccttttcattttatgtttttgtactctgcagactgaaaagacaaagttta       c.*1800

          .         .         .         .         .         .       g.169753
 tcttggccttactgtataaaggtgtgctgtgtccaccgttgtgtacagaatttttcttca       c.*1860

          .         .         .         .                           g.169800
 ttaattttgtgtttaagttaataaaatttatttgtgatgtactgtaa                    c.*1907

 (downstream sequence)
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Eyes absent homolog 1 (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 24
©2004-2020 Leiden University Medical Center