family with sequence similarity 46, member D (FAM46D) - coding DNA reference sequence

(used for variant description)

(last modified May 12, 2021)


This file was created to facilitate the description of sequence variants on transcript NM_001170574.1 in the FAM46D gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering FAM46D transcript NM_001170574.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5034
                           acgcgccccagctcccaccttgggtccttcgcct       c.-301

 .         .         .       | 02 .         .         .             g.5179
 gcacccagtctaacctggcacctaaag | atttcactctgtccttggcccctcaccattgtc    c.-241

 .         .         .         .    | 03    .         .             g.12022
 tcagagtttaagccttaacggatgaaggaaaaag | attatttgtgaaaagaaattatctaa    c.-181

 .         .         .         .         | 04         .             g.108127
 cacttctcatctatctaactggagtttcactagctggag | tttttctggttggtgtattac    c.-121

 .         .         .         .         .         .                g.108187
 tttattcagtgataatatgaaaattactatcttcactgaaggatctactgaataatcatt       c.-61

 .         .         .         .         .  | 05      .             g.112036
 ttaactcaactatattgcattcttgaaagcaatcctttcaat | tgatctactgacttcaca    c.-1

          .         .         .         .         .         .       g.112096
 ATGTCTGAAATCAGATTCACCAATCTCACTTGGGATCAAGTTATAACACTGGATCAAGTG       c.60
 M  S  E  I  R  F  T  N  L  T  W  D  Q  V  I  T  L  D  Q  V         p.20

          .         .         .         .         .         .       g.112156
 TTAGATGAAGTAATTCCAATTCATGGAAAGGGGAATTTCCCCACAATGGAGGTAAAACCA       c.120
 L  D  E  V  I  P  I  H  G  K  G  N  F  P  T  M  E  V  K  P         p.40

          .         .         .         .         .         .       g.112216
 AAAGACATCATTCATGTTGTGAAAGATCAACTCATAGGGCAAGGAATTATTGTTAAAGAT       c.180
 K  D  I  I  H  V  V  K  D  Q  L  I  G  Q  G  I  I  V  K  D         p.60

          .         .         .         .         .         .       g.112276
 GCCAGATTGAATGGTTCCGTAGCAAGTTACATACTTGCAAGCCACAATGGAATCAGCTAT       c.240
 A  R  L  N  G  S  V  A  S  Y  I  L  A  S  H  N  G  I  S  Y         p.80

          .         .         .         .         .         .       g.112336
 AAGGATCTGGACGTTATTTTTGGTGTTGAGCTTCCAGGTAACGAAGAATTTCAGGTTGTT       c.300
 K  D  L  D  V  I  F  G  V  E  L  P  G  N  E  E  F  Q  V  V         p.100

          .         .         .         .         .         .       g.112396
 AAAGATGCAGTTCTAGACTGTCTACTTGACTTTTTACCAAAAGATGTAAAGAAGGAAAAG       c.360
 K  D  A  V  L  D  C  L  L  D  F  L  P  K  D  V  K  K  E  K         p.120

          .         .         .         .         .         .       g.112456
 CTCTCCCCAGATATCATGAAAGACGCTTACGTACAGAAATTGGTCAAGGTTTGCAATGGG       c.420
 L  S  P  D  I  M  K  D  A  Y  V  Q  K  L  V  K  V  C  N  G         p.140

          .         .         .         .         .         .       g.112516
 CATGATTGTTGGAGTCTTATCTCCCTTTCAAATAACACTGGGAAGAATTTAGAACTAAAA       c.480
 H  D  C  W  S  L  I  S  L  S  N  N  T  G  K  N  L  E  L  K         p.160

          .         .         .         .         .         .       g.112576
 TTTGTGAGTTCACTCAGACGGCAGTTTGAATTTAGTGTAGATTCCTTTCAAATTGTTTTG       c.540
 F  V  S  S  L  R  R  Q  F  E  F  S  V  D  S  F  Q  I  V  L         p.180

          .         .         .         .         .         .       g.112636
 GATCCCATGTTAGACTTCTACAGTGACAAAAATGCCAAGCTAACCAAAGAATCCTATCCT       c.600
 D  P  M  L  D  F  Y  S  D  K  N  A  K  L  T  K  E  S  Y  P         p.200

          .         .         .         .         .         .       g.112696
 GTTGTGGTAGCTGAAAGCATGTATGGAGACTTCCAGGAAGCAATGACACATTTGCAACAC       c.660
 V  V  V  A  E  S  M  Y  G  D  F  Q  E  A  M  T  H  L  Q  H         p.220

          .         .         .         .         .         .       g.112756
 AAGCTCATATGTACCAGGAAACCTGAAGAGATTAGAGGTGGTGGCCTTCTGAAGTACTGC       c.720
 K  L  I  C  T  R  K  P  E  E  I  R  G  G  G  L  L  K  Y  C         p.240

          .         .         .         .         .         .       g.112816
 AGCTTGCTGGTTCATGGCTTCAAGCCAGCCTGTATGTCAGAAATCAAAAACCTAGAACGT       c.780
 S  L  L  V  H  G  F  K  P  A  C  M  S  E  I  K  N  L  E  R         p.260

          .         .         .         .         .         .       g.112876
 TATATGTGCTCTAGATTCTTTATTGATTTTCCTCATATAGAAGAACAGCAAAAGAAAATT       c.840
 Y  M  C  S  R  F  F  I  D  F  P  H  I  E  E  Q  Q  K  K  I         p.280

          .         .         .         .         .         .       g.112936
 GAATCATACCTCCACAACCATTTCATAGGTGAAGGAATGACCAAGTATGACTACCTTATG       c.900
 E  S  Y  L  H  N  H  F  I  G  E  G  M  T  K  Y  D  Y  L  M         p.300

          .         .         .         .         .         .       g.112996
 ACCTTGCATGGAGTTGTGAATGAAAGCACTGTTTGCCTCATGAGTTATGAAAGAAGACAG       c.960
 T  L  H  G  V  V  N  E  S  T  V  C  L  M  S  Y  E  R  R  Q         p.320

          .         .         .         .         .         .       g.113056
 ATTCTCCACCTGATCACCATGATGGCTTTGAAAGTACTTGGAGAACTAAATATTCTACCC       c.1020
 I  L  H  L  I  T  M  M  A  L  K  V  L  G  E  L  N  I  L  P         p.340

          .         .         .         .         .         .       g.113116
 AATACACAAAAGGTAACTTGCTTTTATCAGCCTGCTCCGTACTTTGCAGCTGAGGCAAGG       c.1080
 N  T  Q  K  V  T  C  F  Y  Q  P  A  P  Y  F  A  A  E  A  R         p.360

          .         .         .         .         .         .       g.113176
 TACCCTATTTATGTAATACCTGAGCCACCCCCCGTTAGCTTCCAGCCATACCACCCACTG       c.1140
 Y  P  I  Y  V  I  P  E  P  P  P  V  S  F  Q  P  Y  H  P  L         p.380

          .         .         .                                     g.113206
 CACTTTCGTGGATCAAATGGTATGAGTTAA                                     c.1170
 H  F  R  G  S  N  G  M  S  X                                       p.389

          .         .         .         .         .         .       g.113266
 aaaatacacatgcaaccatagaaactttgatttaattaaacaccatttaaaagcaagttt       c.*60

          .         .         .         .         .         .       g.113326
 ccaaatgtaaaattcaagatctgtttttatttttgtacagttaccaattattttcaatta       c.*120

          .         .         .         .         .         .       g.113386
 cagttgatggaatagtagttaccaactatttttgatcaattaagccatcatagtaaatac       c.*180

          .         .         .         .         .         .       g.113446
 aatatctataaaccaaccactttaaatgtttttcaaacgttattgactagctataataac       c.*240

          .         .         .         .         .         .       g.113506
 tttcaaatgttgtgttccccttgaagtgattttcaaatcttttgactacttgtgactttc       c.*300

          .         .         .         .         .         .       g.113566
 aaatttactgtgacaaatatattagagatgcctgcatctttgactataacataaaaggac       c.*360

          .         .         .         .         .         .       g.113626
 agattcatgttttaaaattaagatgtacagtgaagtatcaaattttttatattcagtcag       c.*420

          .         .         .         .         .         .       g.113686
 ttcctttgttacatttagttctttttttctattgaacaataccatcaataaatgttcagt       c.*480

          .         .         .         .         .         .       g.113746
 acttaacagaaatgcctaatttcaaaagcaacagattcagaagacattaaaaccctggac       c.*540

          .         .         .         .         .         .       g.113806
 ttttcaagcatttttttttgacaattaaattgggttggatacaaaaatcctactatagtt       c.*600

          .         .         .         .         .         .       g.113866
 taaaggaatactggaaaaaaatggttctggaaagccctggacattagtaatttgtcatct       c.*660

          .         .         .         .         .         .       g.113926
 atataataaaacatttagttaatttgtggatttgaataacaataccatacagctgtgcaa       c.*720

          .         .         .         .         .         .       g.113986
 ctactactgagatcagatacagggttttttgcccctcaaaataagttaaaacgaatgaaa       c.*780

          .         .         .         .         .         .       g.114046
 atgaccagctctgaatgtgaaagctttctatcatcatctactacaaagagactctaaatg       c.*840

          .         .         .         .         .         .       g.114106
 gcaaacaggaaaaaaacaggcagaggtttatagccatagcatttaccattttatggctta       c.*900

          .         .         .         .         .         .       g.114166
 tttgaaaaacatctttatgttgagaaacattccatttcagtaagttaaaatattttcatt       c.*960

          .         .         .         .         .         .       g.114226
 gtaactaaatgaagcaggtttttcattttgcctttaccaaagatcattttctaacatgcc       c.*1020

          .         .         .         .         .         .       g.114286
 actcaagtgcctcttcgtgtgaatttttgcgtaacactataatttattcaacaactgtat       c.*1080

          .         .         .         .         .         .       g.114346
 acctttacagtatatctaaatatatacttactacatcgagtatactgctagaaaaatcta       c.*1140

          .         .         .         .         .         .       g.114406
 ccagtgggattaaaaatgtattttcttcccataatgaaaataattcatgaccaatattac       c.*1200

          .         .         .         .         .         .       g.114466
 ctgaagtgtcagaagaggagctgtcttaaattaatatggatcaggccattggaaaacttc       c.*1260

          .         .         .         .         .         .       g.114526
 agtatttccacttggttatgattttttgtgagtttccatttcagtttttattgaccatca       c.*1320

          .         .         .         .         .         .       g.114586
 cgttttctatcacaacatgacctgacagttgtatcccgataatttgccagttatagactg       c.*1380

          .         .         .         .         .         .       g.114646
 tgcttatcttcactgtattacaatattggacagaagtacaccaaatacggcattttcaaa       c.*1440

          .         .         .         .         .         .       g.114706
 taaccaatatttctgagatgttttataccacagcacaagtggccatcagtatatttttaa       c.*1500

          .         .         .         .         .         .       g.114766
 agaattatatatcacagaaccctgaggctttaaaacactatggacttaccactttcttga       c.*1560

          .         .         .         .                           g.114808
 caaagaatttgtaattacaataaaatatttagaaatgaaagg                         c.*1602

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Family with sequence similarity 46, member D protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 26c
©2004-2021 Leiden University Medical Center