family with sequence similarity 47, member C (FAM47C) - coding DNA reference sequence

(used for variant description)

(last modified January 4, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_001013736.2 in the FAM47C gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_021373.1, covering FAM47C transcript NM_001013736.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5052
         agggatcaggaaccgcggaaactggagaggtggcaccccagcgagggccacc       c.-1

          .         .         .         .         .         .       g.5112
 ATGGGGGACCAGAGGCCGCAGGACCGGCCCAGTTCCCCGGGCATGGACTCCACGCCCTGG       c.60
 M  G  D  Q  R  P  Q  D  R  P  S  S  P  G  M  D  S  T  P  W         p.20

          .         .         .         .         .         .       g.5172
 TACTGTGACAAACCGCCTTCCAAGTACTTCGCGAAGCGCAAGCACAGGCGCCTGAGGTTC       c.120
 Y  C  D  K  P  P  S  K  Y  F  A  K  R  K  H  R  R  L  R  F         p.40

          .         .         .         .         .         .       g.5232
 CCGCCTGTGGACACCCAGAACTGGGTATTTGTGACGGAGGGCATGGACGACTTCCGCTAC       c.180
 P  P  V  D  T  Q  N  W  V  F  V  T  E  G  M  D  D  F  R  Y         p.60

          .         .         .         .         .         .       g.5292
 GGCTGTCAGTCTCCTGAAGATACGCTTGTTTGTCGCCGTGACGAGTTTTTACTCCCCAAA       c.240
 G  C  Q  S  P  E  D  T  L  V  C  R  R  D  E  F  L  L  P  K         p.80

          .         .         .         .         .         .       g.5352
 ATATCTCTCAGAGGTCCCCAAGCTGACCCCAAAAGCAGGAAGAAAAAGCTGCTCAAGAAA       c.300
 I  S  L  R  G  P  Q  A  D  P  K  S  R  K  K  K  L  L  K  K         p.100

          .         .         .         .         .         .       g.5412
 GCGGCCCTGTTTTCCAAGCTCTCGCCAGCACAGCCAGCACGGAAGGCGTTCGTAGAGGAA       c.360
 A  A  L  F  S  K  L  S  P  A  Q  P  A  R  K  A  F  V  E  E         p.120

          .         .         .         .         .         .       g.5472
 GTGGAAGCCCAGCTGATGACCAAGCATCCCTTGGCCATGTACCCCAATCTGGGAGAAGAT       c.420
 V  E  A  Q  L  M  T  K  H  P  L  A  M  Y  P  N  L  G  E  D         p.140

          .         .         .         .         .         .       g.5532
 ATGCCTCCAGATCTCCTACTACAGGTACTGAAACCGCTGGACCCTGAGAGGAAGCTGGAG       c.480
 M  P  P  D  L  L  L  Q  V  L  K  P  L  D  P  E  R  K  L  E         p.160

          .         .         .         .         .         .       g.5592
 GACGCAGGCTCTTGTGAGGGCCAGGAGAAGACAACTGACGAACCCACGGAGCCTGGTAAA       c.540
 D  A  G  S  C  E  G  Q  E  K  T  T  D  E  P  T  E  P  G  K         p.180

          .         .         .         .         .         .       g.5652
 TACCCCTGTGGGGAATTCTCCCCTCGGCCTCCCGAGACTCGGGTGTCCTGTCTCCCCCCG       c.600
 Y  P  C  G  E  F  S  P  R  P  P  E  T  R  V  S  C  L  P  P         p.200

          .         .         .         .         .         .       g.5712
 GAGCCTCCCAAGACTCCGGTGTCCAGTCTCCGCCCGGAGCCTCCAGAGACTGGAGTGTCC       c.660
 E  P  P  K  T  P  V  S  S  L  R  P  E  P  P  E  T  G  V  S         p.220

          .         .         .         .         .         .       g.5772
 CATCTCCGCCCACAGCCTCCCAAGACTCAGGTGTCCAGTCTCCACCTGGAGCCTCCAGAG       c.720
 H  L  R  P  Q  P  P  K  T  Q  V  S  S  L  H  L  E  P  P  E         p.240

          .         .         .         .         .         .       g.5832
 ACTGGAGTGTCCCATCTCCGCCCAGAGCCTCCCAAGACTCAGGTGTCCAGTCTCCACCTG       c.780
 T  G  V  S  H  L  R  P  E  P  P  K  T  Q  V  S  S  L  H  L         p.260

          .         .         .         .         .         .       g.5892
 GAGCCTCCCGAGACTGGAGTGTCCCATCTCTACCTGGAGCCTCCTGGGACTGGAGTGTCT       c.840
 E  P  P  E  T  G  V  S  H  L  Y  L  E  P  P  G  T  G  V  S         p.280

          .         .         .         .         .         .       g.5952
 CATCTCTGCCCAGAGCCTCCCAAGACTCGCGTATCTCATCTCCATCGGGAGCCTCCTGAG       c.900
 H  L  C  P  E  P  P  K  T  R  V  S  H  L  H  R  E  P  P  E         p.300

          .         .         .         .         .         .       g.6012
 ACTGGAGTGCCTGATCTCTGCCTGGAGCCTCCCAAGTCACGCGTATCTCATCTCCGCCCA       c.960
 T  G  V  P  D  L  C  L  E  P  P  K  S  R  V  S  H  L  R  P         p.320

          .         .         .         .         .         .       g.6072
 GAGCCTTCTGAGACTGGAGTGTCCCATCTCCACCCAGAGCCTCCCAAGACTCTGGTGTCC       c.1020
 E  P  S  E  T  G  V  S  H  L  H  P  E  P  P  K  T  L  V  S         p.340

          .         .         .         .         .         .       g.6132
 AGTCTCCACCCAGAGCCTCCCGAGACTGGAGTGTCCCATCTCTGCCCGGAACCTCCAGAG       c.1080
 S  L  H  P  E  P  P  E  T  G  V  S  H  L  C  P  E  P  P  E         p.360

          .         .         .         .         .         .       g.6192
 ACTCGCGTATCTCCTCTCCGCCAGCTGCCTCCCGAGGCTGGAGTGTCCCATCTCTGCCCG       c.1140
 T  R  V  S  P  L  R  Q  L  P  P  E  A  G  V  S  H  L  C  P         p.380

          .         .         .         .         .         .       g.6252
 GAACCTCCCAAGACTCGCGTACCTCCTCTCCGCCCAGAGACCCCCAAGAATGGAGTGTCT       c.1200
 E  P  P  K  T  R  V  P  P  L  R  P  E  T  P  K  N  G  V  S         p.400

          .         .         .         .         .         .       g.6312
 CCTCTCTTCCCGGAGCCTCCCAAGACTCGCATATCTAATCTCCGCTCGGAGCCTCCCAAG       c.1260
 P  L  F  P  E  P  P  K  T  R  I  S  N  L  R  S  E  P  P  K         p.420

          .         .         .         .         .         .       g.6372
 ATTGGAGTGTCCCATCTCTGCCTGGAGCCTCCCAAGACTCGCGGATCTCATCTCCGCCCG       c.1320
 I  G  V  S  H  L  C  L  E  P  P  K  T  R  G  S  H  L  R  P         p.440

          .         .         .         .         .         .       g.6432
 GAACCTCCTGAGACTGGAGTGTCCCATCTCCGCCCAGAGCCTCCCAAGACTCGGGTGTCC       c.1380
 E  P  P  E  T  G  V  S  H  L  R  P  E  P  P  K  T  R  V  S         p.460

          .         .         .         .         .         .       g.6492
 AGTCTCCACCTGGAGCCTCCTGAGACTGGAGTGTCCCATCTCTGCCCGGAGCCTCCAGAG       c.1440
 S  L  H  L  E  P  P  E  T  G  V  S  H  L  C  P  E  P  P  E         p.480

          .         .         .         .         .         .       g.6552
 AAGGACGTATCTCATCTCCGCCCAGAGCCTCCCGACACTGGAGTGTCCCATCTCTGCCCA       c.1500
 K  D  V  S  H  L  R  P  E  P  P  D  T  G  V  S  H  L  C  P         p.500

          .         .         .         .         .         .       g.6612
 GAGCCCCCCAAGACACGCGTATCTCATCTCCGCCCAGAGCCTTCTGAGACTGGAGTGTCC       c.1560
 E  P  P  K  T  R  V  S  H  L  R  P  E  P  S  E  T  G  V  S         p.520

          .         .         .         .         .         .       g.6672
 CATCTCCGCCCAGAGCCTCCCAAGATTCTGGTGTCCAGTCTCCACCAGGCACCTCCTGAG       c.1620
 H  L  R  P  E  P  P  K  I  L  V  S  S  L  H  Q  A  P  P  E         p.540

          .         .         .         .         .         .       g.6732
 AGTAGCGTATCTCATCTCCGCCCAGAGCCTCCTGAGACTGGAGTGTCCCATCTCCGCCCA       c.1680
 S  S  V  S  H  L  R  P  E  P  P  E  T  G  V  S  H  L  R  P         p.560

          .         .         .         .         .         .       g.6792
 GAGCCTCCCAAGACTCGGATGTACAGTCTCCGCCCGGAGCCTCCCGATACTGGAGTGTCC       c.1740
 E  P  P  K  T  R  M  Y  S  L  R  P  E  P  P  D  T  G  V  S         p.580

          .         .         .         .         .         .       g.6852
 CATCTCTGCCCAGAGCCTCCCAAGACTCGGGTGTCCAGTCTCCCCCCGGAGCCCCCCGAG       c.1800
 H  L  C  P  E  P  P  K  T  R  V  S  S  L  P  P  E  P  P  E         p.600

          .         .         .         .         .         .       g.6912
 ACTGGAGTGTCCCATCTCTGCCCGGAGCCTCCAGAGACTCGCGTATCTCATCTCCGCCCA       c.1860
 T  G  V  S  H  L  C  P  E  P  P  E  T  R  V  S  H  L  R  P         p.620

          .         .         .         .         .         .       g.6972
 GAGCCTCCTGAGACTGGAGTGTCCCATCTCCGCCCAGAGCCTCCCAAGACTCGGATGTAC       c.1920
 E  P  P  E  T  G  V  S  H  L  R  P  E  P  P  K  T  R  M  Y         p.640

          .         .         .         .         .         .       g.7032
 AGTCTCCGCCCGGAGCCTCCCAATACTGGAGTGTCCCATCTCTGCCCAGAGCCTCCCAAG       c.1980
 S  L  R  P  E  P  P  N  T  G  V  S  H  L  C  P  E  P  P  K         p.660

          .         .         .         .         .         .       g.7092
 ACTCGGGTGTCCAGTCTCCCCCCGGAGCCCCCCGAGACTGGAGTGTCCCATCTCTGCCCG       c.2040
 T  R  V  S  S  L  P  P  E  P  P  E  T  G  V  S  H  L  C  P         p.680

          .         .         .         .         .         .       g.7152
 GAGCCTCCAGAGACTCGCGTATCTCATCTCCGCCCAGAGCCTCCTGAGACTGGAGTGTCC       c.2100
 E  P  P  E  T  R  V  S  H  L  R  P  E  P  P  E  T  G  V  S         p.700

          .         .         .         .         .         .       g.7212
 CGTCTCCACCCAGAGCCTCCCAAGACTCGGGTGTCCAGTCTCCACGCGGAGCCTCCTGAG       c.2160
 R  L  H  P  E  P  P  K  T  R  V  S  S  L  H  A  E  P  P  E         p.720

          .         .         .         .         .         .       g.7272
 AGTCGCGTATCTCATCTCTGCCCGGAGCCTCCTGAGACTGGAGTGTCCCATCTCCGCCCA       c.2220
 S  R  V  S  H  L  C  P  E  P  P  E  T  G  V  S  H  L  R  P         p.740

          .         .         .         .         .         .       g.7332
 GAGCCTCCCAAGCCTCGGGTTTCCAGTCTCCGCCCAGAGCCTCTTGAGACTCGCGTATCT       c.2280
 E  P  P  K  P  R  V  S  S  L  R  P  E  P  L  E  T  R  V  S         p.760

          .         .         .         .         .         .       g.7392
 CATCTCCGCCCGGAGCCTCCTGAGACTGGAGTGTCCCATCTCCACCCAGAGCTTCCCAAG       c.2340
 H  L  R  P  E  P  P  E  T  G  V  S  H  L  H  P  E  L  P  K         p.780

          .         .         .         .         .         .       g.7452
 CCTCGGGTATCCAGTCTCCACCTGGAGCCTCCCAAGACTCGTCGAGTGTCCAGTCTCCGC       c.2400
 P  R  V  S  S  L  H  L  E  P  P  K  T  R  R  V  S  S  L  R         p.800

          .         .         .         .         .         .       g.7512
 CTGGAGCCTCCCAAGACTGGTCGGGTGTCCAGTCTCTGCCCGGAGCCTACCAAGACCGGA       c.2460
 L  E  P  P  K  T  G  R  V  S  S  L  C  P  E  P  T  K  T  G         p.820

          .         .         .         .         .         .       g.7572
 GCGTCCCATCTAAAAGAACTGTTTCAGGAAGGTACATCAAGCACAATGGAGTGTGTTTCT       c.2520
 A  S  H  L  K  E  L  F  Q  E  G  T  S  S  T  M  E  C  V  S         p.840

          .         .         .         .         .         .       g.7632
 GACTCTCTTCAACGTAGACACACATCGAGAAAACTCCGTGACTTCAAGTGGGCTGGAGAC       c.2580
 D  S  L  Q  R  R  H  T  S  R  K  L  R  D  F  K  W  A  G  D         p.860

          .         .         .         .         .         .       g.7692
 CTAGGAGTTAATGAAGAATCCATCAGCAGTCTGTTTGACTTTACCCCTGAGTGCAGAGCA       c.2640
 L  G  V  N  E  E  S  I  S  S  L  F  D  F  T  P  E  C  R  A         p.880

          .         .         .         .         .         .       g.7752
 ACCTATCAAGACCAAAAGAATAAGAAGGCAAACGAGTGTTCCTCAGGGCTGAAGTACAGC       c.2700
 T  Y  Q  D  Q  K  N  K  K  A  N  E  C  S  S  G  L  K  Y  S         p.900

          .         .         .         .         .         .       g.7812
 ATGGAGCTAGACGAAATGGATGAGGTCAAATTCTTCTCACAGGAAAAAGACTTGGACGGG       c.2760
 M  E  L  D  E  M  D  E  V  K  F  F  S  Q  E  K  D  L  D  G         p.920

          .         .         .         .         .         .       g.7872
 AAAATCCAGAATGCACCAAATTCTCATAGTGCACAGCATGTGAAGATGGGGTATGGAGCA       c.2820
 K  I  Q  N  A  P  N  S  H  S  A  Q  H  V  K  M  G  Y  G  A         p.940

          .         .         .         .         .         .       g.7932
 TGGTACCTCAAGCCTAAGTTGGGGAAAAAGCTAAGAAGTGATGAACCTTTGATTGACCCC       c.2880
 W  Y  L  K  P  K  L  G  K  K  L  R  S  D  E  P  L  I  D  P         p.960

          .         .         .         .         .         .       g.7992
 AAGCTCGTACTTGAAAAGCCTGATGAACCCGACATTCTTGACGGTCTTTATGGACCAATC       c.2940
 K  L  V  L  E  K  P  D  E  P  D  I  L  D  G  L  Y  G  P  I         p.980

          .         .         .         .         .         .       g.8052
 GCCTTTAAGGATTTCATTCTAAGCAAGGGCTATGAAATGCCTGGCATCATTCAAAGGCTG       c.3000
 A  F  K  D  F  I  L  S  K  G  Y  E  M  P  G  I  I  Q  R  L         p.1000

          .         .         .         .         .         .       g.8112
 TTTGCCAGGAGGGGATGGACTTATGACTCTGTTAAGACTCCTATTCAACGTGCAATGCAA       c.3060
 F  A  R  R  G  W  T  Y  D  S  V  K  T  P  I  Q  R  A  M  Q         p.1020

          .         .         .         .                           g.8160
 GTTTACAAGTACAAAGAAGACGTCACAGATGCATCGGAAGAAGATTAG                   c.3108
 V  Y  K  Y  K  E  D  V  T  D  A  S  E  E  D  X                     p.1035

          .         .         .         .         .         .       g.8220
 atggttttgaatttactagttaattgggtatttcttgctctcattttaaacatcagtcag       c.*60

          .         .         .         .         .         .       g.8280
 aatttatgatgactggccccaggaatgtacaacgttggcaacatctgtaaattcaatacc       c.*120

          .         .                                               g.8308
 taatgtttataaatatttcttaatgacc                                       c.*148

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Family with sequence similarity 47, member C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center