ferredoxin 1-like (FDX1L) - coding DNA reference sequence

(used for variant description)

(last modified October 12, 2013)

This file was created to facilitate the description of sequence variants on transcript NM_001031734.2 in the FDX1L gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering FDX1L transcript NM_001031734.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5019
                                          gagtcacgtgatgcatgtc       c.-1

          .         .         .         .         .         .       g.5079
 ATGGCCGCCTCCATGGCCCGGGGAGGCGTGAGTGCCAGGGTTCTACTGCAGGCTGCCAGG       c.60
 M  A  A  S  M  A  R  G  G  V  S  A  R  V  L  L  Q  A  A  R         p.20

          .         .         .         .         .         .       g.5139
 GGCACCTGGTGGAACAGACCTGGGGGCACTTCCGGGTCGGGGGAGGGGGTGGCGCTGGGG       c.120
 G  T  W  W  N  R  P  G  G  T  S  G  S  G  E  G  V  A  L  G         p.40

          .         .      | 02  .         .         .         .    g.5291
 ACAACCAGAAAGTTTCAAGCGACAG | GCTCGCGCCCGGCTGGAGAGGAGGACGCGGGCGGC    c.180
 T  T  R  K  F  Q  A  T  G |   S  R  P  A  G  E  E  D  A  G  G      p.60

          .         . | 03       .         .         .         .    g.5563
 CCGGAGCGGCCCGGGGACGT | GGTGAACGTGGTGTTCGTAGACCGCTCAGGCCAGCGGATC    c.240
 P  E  R  P  G  D  V  |  V  N  V  V  F  V  D  R  S  G  Q  R  I      p.80

          .         .         .         .         .         .       g.5623
 CCAGTGAGTGGCAGAGTCGGGGACAATGTTCTTCACCTGGCCCAGCGCCACGGGGTGGAC       c.300
 P  V  S  G  R  V  G  D  N  V  L  H  L  A  Q  R  H  G  V  D         p.100

         | 04.         .         .         .         .         .    g.10128
 CTGGAAG | GGGCCTGTGAAGCCTCCCTGGCCTGCTCCACCTGCCATGTGTATGTGAGTGAA    c.360
 L  E  G |   A  C  E  A  S  L  A  C  S  T  C  H  V  Y  V  S  E      p.120

          .         .         .      | 05  .         .         .    g.10398
 GACCACCTGGATCTCCTGCCTCCTCCCGAGGAGAG | GGAAGACGACATGCTAGACATGGCC    c.420
 D  H  L  D  L  L  P  P  P  E  E  R  |  E  D  D  M  L  D  M  A      p.140

          .         .         .         .         .         .       g.10458
 CCCCTCCTCCAGGAGAACTCGCGGCTGGGCTGCCAGATTGTGCTGACACCGGAGCTGGAA       c.480
 P  L  L  Q  E  N  S  R  L  G  C  Q  I  V  L  T  P  E  L  E         p.160

          .         .         .         .         .         .       g.10518
 GGAGCGGAATTCACCCTGCCCAAGATCACCAGGAACTTCTACGTGGATGGCCATGTCCCC       c.540
 G  A  E  F  T  L  P  K  I  T  R  N  F  Y  V  D  G  H  V  P         p.180

          .                                                         g.10530
 AAGCCCCACTGA                                                       c.552
 K  P  H  X                                                         p.183

          .         .         .         .         .         .       g.10590
 catgaacacctggaccattccacattgccatggccccagggcccagattgagggaatagc       c.*60

          .         .         .         .         .         .       g.10650
 caggtgccagccctgcccagagtgcggacaggcccgggagagacgtggaagcccctgtga       c.*120

          .         .         .         .         .         .       g.10710
 aggacaacacccctgcttgggagagagtcccatgtccaggctctggtggggacagggccc       c.*180

          .         .         .         .         .         .       g.10770
 ctagtggggtggccttccccaggcccctgagaatcagggtttgagtaggagtggactcat       c.*240

          .         .         .                                     g.10801
 attggagctgcaataaatcgataacacaggc                                    c.*271

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ferredoxin 1-like protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.