fibroblast growth factor 10 (FGF10) - coding DNA reference sequence

(used for variant description)

(last modified February 22, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_004465.1 in the FGF10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011446.1, covering FGF10 transcript NM_004465.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 ATGTGGAAATGGATACTGACACATTGTGCCTCAGCCTTTCCCCACCTGCCCGGCTGCTGC       c.60
 M  W  K  W  I  L  T  H  C  A  S  A  F  P  H  L  P  G  C  C         p.20

          .         .         .         .         .         .       g.120
 TGCTGCTGCTTTTTGTTGCTGTTCTTGGTGTCTTCCGTCCCTGTCACCTGCCAAGCCCTT       c.120
 C  C  C  F  L  L  L  F  L  V  S  S  V  P  V  T  C  Q  A  L         p.40

          .         .         .         .         .         .       g.180
 GGTCAGGACATGGTGTCACCAGAGGCCACCAACTCTTCTTCCTCCTCCTTCTCCTCTCCT       c.180
 G  Q  D  M  V  S  P  E  A  T  N  S  S  S  S  S  F  S  S  P         p.60

          .         .         .         .         .         .       g.240
 TCCAGCGCGGGAAGGCATGTGCGGAGCTACAATCACCTTCAAGGAGATGTCCGCTGGAGA       c.240
 S  S  A  G  R  H  V  R  S  Y  N  H  L  Q  G  D  V  R  W  R         p.80

          .         .         .         .         .         .       g.300
 AAGCTATTCTCTTTCACCAAGTACTTTCTCAAGATTGAGAAGAACGGGAAGGTCAGCGGG       c.300
 K  L  F  S  F  T  K  Y  F  L  K  I  E  K  N  G  K  V  S  G         p.100

          .         .      | 02  .         .         .         .    g.78187
 ACCAAGAAGGAGAACTGCCCGTACA | GCATCCTGGAGATAACATCAGTAGAAATCGGAGTT    c.360
 T  K  K  E  N  C  P  Y  S |   I  L  E  I  T  S  V  E  I  G  V      p.120

          .         .         .         .         .         .       g.78247
 GTTGCCGTCAAAGCCATTAACAGCAACTATTACTTAGCCATGAACAAGAAGGGGAAACTC       c.420
 V  A  V  K  A  I  N  S  N  Y  Y  L  A  M  N  K  K  G  K  L         p.140

           | 03        .         .         .         .         .    g.83541
 TATGGCTCA | AAAGAATTTAACAATGACTGTAAGCTGAAGGAGAGGATAGAGGAAAATGGA    c.480
 Y  G  S   | K  E  F  N  N  D  C  K  L  K  E  R  I  E  E  N  G      p.160

          .         .         .         .         .         .       g.83601
 TACAATACCTATGCATCATTTAACTGGCAGCATAATGGGAGGCAAATGTATGTGGCATTG       c.540
 Y  N  T  Y  A  S  F  N  W  Q  H  N  G  R  Q  M  Y  V  A  L         p.180

          .         .         .         .         .         .       g.83661
 AATGGAAAAGGAGCTCCAAGGAGAGGACAGAAAACACGAAGGAAAAACACCTCTGCTCAC       c.600
 N  G  K  G  A  P  R  R  G  Q  K  T  R  R  K  N  T  S  A  H         p.200

          .         .                                               g.83688
 TTTCTTCCAATGGTGGTACACTCATAG                                        c.627
 F  L  P  M  V  V  H  S  X                                          p.208

 

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Fibroblast growth factor 10 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.