fibroblast growth factor 14 (FGF14) - coding DNA reference sequence

(used for variant description)

(last modified December 21, 2022)


This file was created to facilitate the description of sequence variants on transcript NM_004115.3 in the FGF14 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000013.10, covering FGF14 transcript NM_004115.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
          .         .         .         .         .         .       g.60
 ATGGCCGCGGCCATCGCTAGCGGCTTGATCCGCCAGAAGCGGCAGGCGCGGGAGCAGCAC       c.60
 M  A  A  A  I  A  S  G  L  I  R  Q  K  R  Q  A  R  E  Q  H         p.20

          .         .         .         .         .         .       g.120
 TGGGACCGGCCGTCTGCCAGCAGGAGGCGGAGCAGCCCCAGCAAGAACCGCGGGCTCTGC       c.120
 W  D  R  P  S  A  S  R  R  R  S  S  P  S  K  N  R  G  L  C         p.40

          .         .         .         .         .         .       g.180
 AACGGCAACCTGGTGGATATCTTCTCCAAAGTGCGCATCTTCGGCCTCAAGAAGCGCAGG       c.180
 N  G  N  L  V  D  I  F  S  K  V  R  I  F  G  L  K  K  R  R         p.60

          .    | 02    .         .         .         .         .    g.41396
 TTGCGGCGCCAAG | ATCCCCAGCTCAAGGGTATAGTGACCAGGTTATATTGCAGGCAAGGC    c.240
 L  R  R  Q  D |   P  Q  L  K  G  I  V  T  R  L  Y  C  R  Q  G      p.80

          .         .         .         .         .         .       g.41456
 TACTACTTGCAAATGCACCCCGATGGAGCTCTCGATGGAACCAAGGATGACAGCACTAAT       c.300
 Y  Y  L  Q  M  H  P  D  G  A  L  D  G  T  K  D  D  S  T  N         p.100

      | 03   .         .         .         .         .         .    g.47873
 TCTA | CACTCTTCAACCTCATACCAGTGGGACTACGTGTTGTTGCCATCCAGGGAGTGAAA    c.360
 S  T |   L  F  N  L  I  P  V  G  L  R  V  V  A  I  Q  G  V  K      p.120

          .         .         .         .         | 04         .    g.189847
 ACAGGGTTGTATATAGCCATGAATGGAGAAGGTTACCTCTACCCATCA | GAACTTTTTACC    c.420
 T  G  L  Y  I  A  M  N  G  E  G  Y  L  Y  P  S   | E  L  F  T      p.140

          .         .         .         .         .         .       g.189907
 CCTGAATGCAAGTTTAAAGAATCTGTTTTTGAAAATTATTATGTAATCTACTCATCCATG       c.480
 P  E  C  K  F  K  E  S  V  F  E  N  Y  Y  V  I  Y  S  S  M         p.160

          .         .         .         .         .         .       g.189967
 TTGTACAGACAACAGGAATCTGGTAGAGCCTGGTTTTTGGGATTAAATAAGGAAGGGCAA       c.540
 L  Y  R  Q  Q  E  S  G  R  A  W  F  L  G  L  N  K  E  G  Q         p.180

          .         .         .         .         .         .       g.190027
 GCTATGAAAGGGAACAGAGTAAAGAAAACCAAACCAGCAGCTCATTTTCTACCCAAGCCA       c.600
 A  M  K  G  N  R  V  K  K  T  K  P  A  A  H  F  L  P  K  P         p.200

         | 05.         .         .         .         .         .    g.193731
 TTGGAAG | TTGCCATGTACCGAGAACCATCTTTGCATGATGTTGGGGAAACGGTCCCGAAG    c.660
 L  E  V |   A  M  Y  R  E  P  S  L  H  D  V  G  E  T  V  P  K      p.220

          .         .         .         .         .         .       g.193791
 CCTGGGGTGACGCCAAGTAAAAGCACAAGTGCGTCTGCAATAATGAATGGAGGCAAACCA       c.720
 P  G  V  T  P  S  K  S  T  S  A  S  A  I  M  N  G  G  K  P         p.240

          .         .                                               g.193815
 GTCAACAAGAGTAAGACAACATAG                                           c.744
 V  N  K  S  K  T  T  X                                             p.247

          .         .         .         .         .         .       g.193875
 ccagatcctcacaggtgttgtgacttattcgtcctgagcacagttgagtgatttatcctc       c.*60

          .         .         .         .         .         .       g.193935
 accagacattcctgctccgtggctgaagagcagcaggaagtaagctaatgcttattcttt       c.*120

          .         .         .         .         .         .       g.193995
 gctgtctccgaacttctctgttgcaagtggataaatctcaacctgttgcaccccccacaa       c.*180

          .         .         .         .         .         .       g.194055
 caagaagacacctggataaccagctaaactcagaccatggaatgccctaccagatatgga       c.*240

          .         .         .         .         .         .       g.194115
 atgcctttttaatatcttttctgtgactgtgacacttcatgtgaatgacatacttcacaa       c.*300

          .         .         .         .         .         .       g.194175
 gtacactcgataccttgcctgctgacagctacccataatcctttttgagtcctgtttcag       c.*360

          .         .         .         .         .         .       g.194235
 cgaaatctatgtgtttaagttcaattttgtagcacacaaataatattgagtaatttctag       c.*420

          .         .         .         .         .         .       g.194295
 ttagacgctgtaaacctgtgctattacggatttctcttcttcccatttttacagggctgc       c.*480

          .         .         .         .         .         .       g.194355
 tcgctccactgtctgtgaccttttgcagggattttgttcctctaaatcttaaatgttgca       c.*540

          .         .         .         .         .         .       g.194415
 gttggcttaggtcggagagcaatcagggaatcaggaagccttctaaacctattattacaa       c.*600

          .         .         .         .         .         .       g.194475
 attgcatctataaagaaagattaagaaagattgttgtctctggctcacactatcgattaa       c.*660

          .         .         .         .         .         .       g.194535
 acacacatatacgctctgtccagtagcagatactgtgctcccaaggtcggcattgcctgg       c.*720

          .         .         .         .         .         .       g.194595
 gtgggaaatggctcaaacacaatccagggaagctctctatgatatgtgtttgacatcccc       c.*780

          .         .         .         .         .         .       g.194655
 ctctagtttctttgtgtgtgtgtgttttatacatatcacaagcttactggtaatggtaac       c.*840

          .         .         .         .         .         .       g.194715
 atttgccttgcccagcgagcaagacccactggtttttgagaaagtgggtccaaagatttc       c.*900

          .         .         .         .         .         .       g.194775
 tgtaggccttgtaggcctgattaaggttcatttttcatctattaattctcattatttgga       c.*960

          .         .         .         .         .         .       g.194835
 aaaaaaaaaaaaggaaaatcagtaattataacctacaagaattgcgctacctaaatccat       c.*1020

          .         .         .         .         .         .       g.194895
 ttcagatatactccgtcctgtttttaatgaaccaaacttaacgccatccccgtttctggc       c.*1080

          .         .         .         .         .         .       g.194955
 tgcgttcccctcatactcagcagagcatgggcaagacggctgttgtgttctttcctgcag       c.*1140

          .         .         .         .         .         .       g.195015
 cagcaatgcaaacgttagttataaattaattagactttaatatttttggtgtttaatgac       c.*1200

          .         .         .         .         .         .       g.195075
 aagtttttaaactggacatattaggaaaaatattttttttagctcagcatgctgagtccg       c.*1260

          .         .         .         .         .         .       g.195135
 gtactgtgtatttcaccagtacatgcctctagctcagcatctggggctcatgttgcccag       c.*1320

          .         .         .         .         .         .       g.195195
 tggctgggttagaggtgccttgccatgatctcagaatacagtctgttgaattatcctaga       c.*1380

          .         .         .         .         .         .       g.195255
 tgaaaataaaggcaaaccaacacattcatccatgaggattttggtccattccatttattt       c.*1440

          .         .         .         .         .         .       g.195315
 tcttttattttgcattcttaatttcctttttagtttaacactgtttgtttgagcttaggg       c.*1500

          .         .         .         .         .         .       g.195375
 aagacaactaccaagaaaggccaggaacagttgactacacaatgaagattccatgcaaaa       c.*1560

          .         .         .         .         .         .       g.195435
 tgttcaatattggatctaaaggggttcaaaatgtttcatactaaactgtttgggaattta       c.*1620

          .         .         .         .         .         .       g.195495
 tttgttaactctgtgtacacctaataaaattcaatgttttcttctcagaagagttcattg       c.*1680

          .         .         .         .         .         .       g.195555
 agaccaaactgaacctcatttattgaaaattatatgtgggatcaatgtactggcctcttg       c.*1740

          .         .         .         .         .         .       g.195615
 ttattctttctatgtgggaggatgacccagtcatcattttccccatctgcactgtattta       c.*1800

          .         .         .         .         .         .       g.195675
 ttgggaaattattttgtcactgctttcataaatcttcttcatgacagcccttgcccagca       c.*1860

          .         .         .         .         .         .       g.195735
 ttaaaaaattctggcctgcttagctgattaaaggtttagtagaaatttaactgtttgttt       c.*1920

          .         .         .         .         .                 g.195791
 atgcttatttcattttcatattggattctacttgaataaataaaaagttagcagaa           c.*1976

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Fibroblast growth factor 14 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 28
©2004-2022 Leiden University Medical Center