fibroblast growth factor 14 (FGF14) - coding DNA reference sequence

(used for variant description)

(last modified December 22, 2022)


This file was created to facilitate the description of sequence variants on transcript NM_175929.2 in the FGF14 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000013.10, covering FGF14 transcript NM_175929.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5036
                         ctggccgaaaacaaacaatcactgagaagtctcaaa       c.-61

 .         .         .         .         .         .                g.5096
 gaaatataccacgtgaggggaaaaaactgggagaagatccggaatattatcgtttttcct       c.-1

          .         .         .         .         .         .       g.5156
 ATGGTAAAACCGGTGCCCCTCTTCAGGAGAACTGATTTCAAATTATTATTATGCAACCAC       c.60
 M  V  K  P  V  P  L  F  R  R  T  D  F  K  L  L  L  C  N  H         p.20

          .         .         .         .         .         .       g.5216
 AAGGATCTCTTCTTTCTCAGGGTGTCTAAGCTGCTGGATTGCTTTTCGCCCAAATCAATG       c.120
 K  D  L  F  F  L  R  V  S  K  L  L  D  C  F  S  P  K  S  M         p.40

          .         .         .         .         .         .       g.5276
 TGGTTTCTTTGGAACATTTTCAGCAAAGGAACGCATATGCTGCAGTGTCTTTGTGGCAAG       c.180
 W  F  L  W  N  I  F  S  K  G  T  H  M  L  Q  C  L  C  G  K         p.60

          .         .         | 02         .         .         .    g.531510
 AGTCTTAAGAAAAACAAGAACCCAACTG | ATCCCCAGCTCAAGGGTATAGTGACCAGGTTA    c.240
 S  L  K  K  N  K  N  P  T  D |   P  Q  L  K  G  I  V  T  R  L      p.80

          .         .         .         .         .         .       g.531570
 TATTGCAGGCAAGGCTACTACTTGCAAATGCACCCCGATGGAGCTCTCGATGGAACCAAG       c.300
 Y  C  R  Q  G  Y  Y  L  Q  M  H  P  D  G  A  L  D  G  T  K         p.100

          .          | 03        .         .         .         .    g.537987
 GATGACAGCACTAATTCTA | CACTCTTCAACCTCATACCAGTGGGACTACGTGTTGTTGCC    c.360
 D  D  S  T  N  S  T |   L  F  N  L  I  P  V  G  L  R  V  V  A      p.120

          .         .         .         .         .         .       g.538047
 ATCCAGGGAGTGAAAACAGGGTTGTATATAGCCATGAATGGAGAAGGTTACCTCTACCCA       c.420
 I  Q  G  V  K  T  G  L  Y  I  A  M  N  G  E  G  Y  L  Y  P         p.140

     | 04    .         .         .         .         .         .    g.680021
 TCA | GAACTTTTTACCCCTGAATGCAAGTTTAAAGAATCTGTTTTTGAAAATTATTATGTA    c.480
 S   | E  L  F  T  P  E  C  K  F  K  E  S  V  F  E  N  Y  Y  V      p.160

          .         .         .         .         .         .       g.680081
 ATCTACTCATCCATGTTGTACAGACAACAGGAATCTGGTAGAGCCTGGTTTTTGGGATTA       c.540
 I  Y  S  S  M  L  Y  R  Q  Q  E  S  G  R  A  W  F  L  G  L         p.180

          .         .         .         .         .         .       g.680141
 AATAAGGAAGGGCAAGCTATGAAAGGGAACAGAGTAAAGAAAACCAAACCAGCAGCTCAT       c.600
 N  K  E  G  Q  A  M  K  G  N  R  V  K  K  T  K  P  A  A  H         p.200

          .         .   | 05     .         .         .         .    g.683845
 TTTCTACCCAAGCCATTGGAAG | TTGCCATGTACCGAGAACCATCTTTGCATGATGTTGGG    c.660
 F  L  P  K  P  L  E  V |   A  M  Y  R  E  P  S  L  H  D  V  G      p.220

          .         .         .         .         .         .       g.683905
 GAAACGGTCCCGAAGCCTGGGGTGACGCCAAGTAAAAGCACAAGTGCGTCTGCAATAATG       c.720
 E  T  V  P  K  P  G  V  T  P  S  K  S  T  S  A  S  A  I  M         p.240

          .         .         .                                     g.683944
 AATGGAGGCAAACCAGTCAACAAGAGTAAGACAACATAG                            c.759
 N  G  G  K  P  V  N  K  S  K  T  T  X                              p.252

          .         .         .         .         .         .       g.684004
 ccagatcctcacaggtgttgtgacttattcgtcctgagcacagttgagtgatttatcctc       c.*60

          .         .         .         .         .         .       g.684064
 accagacattcctgctccgtggctgaagagcagcaggaagtaagctaatgcttattcttt       c.*120

          .         .         .         .         .         .       g.684124
 gctgtctccgaacttctctgttgcaagtggataaatctcaacctgttgcaccccccacaa       c.*180

          .         .         .         .         .         .       g.684184
 caagaagacacctggataaccagctaaactcagaccatggaatgccctaccagatatgga       c.*240

          .         .         .         .         .         .       g.684244
 atgcctttttaatatcttttctgtgactgtgacacttcatgtgaatgacatacttcacaa       c.*300

          .         .         .         .         .         .       g.684304
 gtacactcgataccttgcctgctgacagctacccataatcctttttgagtcctgtttcag       c.*360

          .         .         .         .         .         .       g.684364
 cgaaatctatgtgtttaagttcaattttgtagcacacaaataatattgagtaatttctag       c.*420

          .         .         .         .         .         .       g.684424
 ttagacgctgtaaacctgtgctattacggatttctcttcttcccatttttacagggctgc       c.*480

          .         .         .         .         .         .       g.684484
 tcgctccactgtctgtgaccttttgcagggattttgttcctctaaatcttaaatgttgca       c.*540

          .         .         .         .         .         .       g.684544
 gttggcttaggtcggagagcaatcagggaatcaggaagccttctaaacctattattacaa       c.*600

          .         .         .         .         .         .       g.684604
 attgcatctataaagaaagattaagaaagattgttgtctctggctcacactatcgattaa       c.*660

          .         .         .         .         .         .       g.684664
 acacacatatacgctctgtccagtagcagatactgtgctcccaaggtcggcattgcctgg       c.*720

          .         .         .         .         .         .       g.684724
 gtgggaaatggctcaaacacaatccagggaagctctctatgatatgtgtttgacatcccc       c.*780

          .         .         .         .         .         .       g.684784
 ctctagtttctttgtgtgtgtgtgttttatacatatcacaagcttactggtaatggtaac       c.*840

          .         .         .         .         .         .       g.684844
 atttgccttgcccagcgagcaagacccactggtttttgagaaagtgggtccaaagatttc       c.*900

          .         .         .         .         .         .       g.684904
 tgtaggccttgtaggcctgattaaggttcatttttcatctattaattctcattatttgga       c.*960

          .         .         .         .         .         .       g.684964
 aaaaaaaaaaaaggaaaatcagtaattataacctacaagaattgcgctacctaaatccat       c.*1020

          .         .         .         .         .         .       g.685024
 ttcagatatactccgtcctgtttttaatgaaccaaacttaacgccatccccgtttctggc       c.*1080

          .         .         .         .         .         .       g.685084
 tgcgttcccctcatactcagcagagcatgggcaagacggctgttgtgttctttcctgcag       c.*1140

          .         .         .         .         .         .       g.685144
 cagcaatgcaaacgttagttataaattaattagactttaatatttttggtgtttaatgac       c.*1200

          .         .         .         .         .         .       g.685204
 aagtttttaaactggacatattaggaaaaatattttttttagctcagcatgctgagtccg       c.*1260

          .         .         .         .         .         .       g.685264
 gtactgtgtatttcaccagtacatgcctctagctcagcatctggggctcatgttgcccag       c.*1320

          .         .         .         .         .         .       g.685324
 tggctgggttagaggtgccttgccatgatctcagaatacagtctgttgaattatcctaga       c.*1380

          .         .         .         .         .         .       g.685384
 tgaaaataaaggcaaaccaacacattcatccatgaggattttggtccattccatttattt       c.*1440

          .         .         .         .         .         .       g.685444
 tcttttattttgcattcttaatttcctttttagtttaacactgtttgtttgagcttaggg       c.*1500

          .         .         .         .         .         .       g.685504
 aagacaactaccaagaaaggccaggaacagttgactacacaatgaagattccatgcaaaa       c.*1560

          .         .         .         .         .         .       g.685564
 tgttcaatattggatctaaaggggttcaaaatgtttcatactaaactgtttgggaattta       c.*1620

          .         .         .         .         .         .       g.685624
 tttgttaactctgtgtacacctaataaaattcaatgttttcttctcagaagagttcattg       c.*1680

          .         .         .         .         .         .       g.685684
 agaccaaactgaacctcatttattgaaaattatatgtgggatcaatgtactggcctcttg       c.*1740

          .         .         .         .         .         .       g.685744
 ttattctttctatgtgggaggatgacccagtcatcattttccccatctgcactgtattta       c.*1800

          .         .         .         .         .         .       g.685804
 ttgggaaattattttgtcactgctttcataaatcttcttcatgacagcccttgcccagca       c.*1860

          .         .         .         .         .         .       g.685864
 ttaaaaaattctggcctgcttagctgattaaaggtttagtagaaatttaactgtttgttt       c.*1920

          .         .         .         .         .                 g.685920
 atgcttatttcattttcatattggattctacttgaataaataaaaagttagcagaa           c.*1976

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Fibroblast growth factor 14 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 28
©2004-2022 Leiden University Medical Center