fibroblast growth factor 3 (FGF3) - coding DNA reference sequence

(used for variant description)

(last modified September 9, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_005247.2 in the FGF3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009016.1, covering FGF3 transcript NM_005247.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5011
                                                  gacctttcaga       c.-481

 .         .         .         .         .         .                g.5071
 gccaggagggctttcgggggcgtggggcgcgctgcggagcggagccgcggctcgacggcg       c.-421

 .         .         .         .         .         .                g.5131
 gtgcgctggcggcgagtgtatgcagacggcgcccggcccgaaccccgagccccgcggggc       c.-361

 .         .         .         .         .         .                g.5191
 tccccacccgccggcctcccgcccctcccgcgcctccgcctggggaccacgtcggccttt       c.-301

 .         .         .         .         .         .                g.5251
 tgttggcgaaccgtcctttctttcagcgctttgcgcagcaacggaaatttcattgctcct       c.-241

 .         .         .         .         .         .                g.5311
 gggtggaaattaaagggactcgcgttccctctctccctctccctctcccactctccctct       c.-181

 .         .         .         .         .         .                g.5371
 ctttctctctctcgcccacccttcccccttcttcccccacctttcccgcgaagccggagt       c.-121

 .         .         .         .         .         .                g.5431
 cagcatctccaggcgcgggatcccgctccgagcacctcgcagctgtccggctgccgcccc       c.-61

 .         .         .         .         .         .                g.5491
 ttccatgggcgccgcgctcgcctgcagccgccgccgccgcggggcgggcgcgatgccacg       c.-1

          .         .         .         .         .         .       g.5551
 ATGGGCCTAATCTGGCTGCTACTGCTCAGCCTGCTGGAGCCCGGCTGGCCCGCAGCGGGC       c.60
 M  G  L  I  W  L  L  L  L  S  L  L  E  P  G  W  P  A  A  G         p.20

          .         .         .         .         .         .       g.5611
 CCTGGGGCGCGGTTGCGGCGCGATGCGGGCGGCCGTGGCGGCGTCTACGAGCACCTTGGC       c.120
 P  G  A  R  L  R  R  D  A  G  G  R  G  G  V  Y  E  H  L  G         p.40

          .         .         .         .         .         .       g.5671
 GGGGCGCCCCGGCGCCGCAAGCTCTACTGCGCCACGAAGTACCACCTCCAGCTGCACCCG       c.180
 G  A  P  R  R  R  K  L  Y  C  A  T  K  Y  H  L  Q  L  H  P         p.60

          .         .         .         . | 02       .         .    g.8021
 AGCGGCCGCGTCAACGGCAGCCTGGAGAACAGCGCCTACA | GTATTTTGGAGATAACGGCA    c.240
 S  G  R  V  N  G  S  L  E  N  S  A  Y  S |   I  L  E  I  T  A      p.80

          .         .         .         .         .         .       g.8081
 GTGGAGGTGGGCATTGTGGCCATCAGGGGTCTCTTCTCCGGGCGGTACCTGGCCATGAAC       c.300
 V  E  V  G  I  V  A  I  R  G  L  F  S  G  R  Y  L  A  M  N         p.100

          .         .     | 03   .         .         .         .    g.13760
 AAGAGGGGACGACTCTATGCTTCG | GAGCACTACAGCGCCGAGTGCGAGTTTGTGGAGCGG    c.360
 K  R  G  R  L  Y  A  S   | E  H  Y  S  A  E  C  E  F  V  E  R      p.120

          .         .         .         .         .         .       g.13820
 ATCCACGAGCTGGGCTATAATACGTATGCCTCCCGGCTGTACCGGACGGTGTCTAGTACG       c.420
 I  H  E  L  G  Y  N  T  Y  A  S  R  L  Y  R  T  V  S  S  T         p.140

          .         .         .         .         .         .       g.13880
 CCTGGGGCCCGCCGGCAGCCCAGCGCCGAGAGACTGTGGTACGTGTCTGTGAACGGCAAG       c.480
 P  G  A  R  R  Q  P  S  A  E  R  L  W  Y  V  S  V  N  G  K         p.160

          .         .         .         .         .         .       g.13940
 GGCCGGCCCCGCAGGGGCTTCAAGACCCGCCGCACACAGAAGTCCTCCCTGTTCCTGCCC       c.540
 G  R  P  R  R  G  F  K  T  R  R  T  Q  K  S  S  L  F  L  P         p.180

          .         .         .         .         .         .       g.14000
 CGCGTGCTGGACCACAGGGACCACGAGATGGTGCGGCAGCTACAGAGTGGGCTGCCCAGA       c.600
 R  V  L  D  H  R  D  H  E  M  V  R  Q  L  Q  S  G  L  P  R         p.200

          .         .         .         .         .         .       g.14060
 CCCCCTGGTAAGGGGGTCCAGCCCCGACGGCGGCGGCAGAAGCAGAGCCCGGATAACCTG       c.660
 P  P  G  K  G  V  Q  P  R  R  R  R  Q  K  Q  S  P  D  N  L         p.220

          .         .         .         .         .         .       g.14120
 GAGCCCTCTCACGTTCAGGCTTCGAGACTGGGCTCCCAGCTGGAGGCCAGTGCGCACTAG       c.720
 E  P  S  H  V  Q  A  S  R  L  G  S  Q  L  E  A  S  A  H  X         p.239

          .         .         .         .         .         .       g.14180
 ctgggcctggtggccaccgccagagctcctggcgacatcttggcgtggcagcctcttgac       c.*60

          .         .         .         .         .         .       g.14240
 tctgactctcctccttgagcccttgcccctgcgtcccgcgtctgggttctcagctatttc       c.*120

          .         .         .         .         .         .       g.14300
 cagagccagctcaaatcagggtccagtgggaactgaagagggcccaagtcggagctcgga       c.*180

          .         .         .         .         .         .       g.14360
 gggggctgcctgcaatgcagggcatttgtgggtctgtgtggcaggaagccggcagggaag       c.*240

          .         .         .         .         .         .       g.14420
 ggcctgagtgccagccctggcagactgaggagcctcccaggagcagcggggcagtgtggg       c.*300

          .         .         .                                     g.14457
 gctttgtgtcatcacaacattaaagtattttattcta                              c.*337

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Fibroblast growth factor 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.