four and a half LIM domains 1 (FHL1) - 427 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.64947
gtaacgggcatccccatgtgccaatgggaagggctgggttttggagtgtcctttgcccac  c.156+60

         .         .         .         .         .         .  g.65007
aaccatggcagcagcagctggctgttaggatttcccagcatcactgcagccaccttgagg  c.156+120

         .         .         .         .         .         .  g.65067
cctcaaggaagcctcctccactccccaggccacagtggcccgagctgtttaatgtggggc  c.156+180

         .         .         .      g.65101
ttgactggatgggcgccagcgcccttgccagctc  c.156+214

--------------------- middle of intron ---------------------
                g.65102       .         .         .           g.65134
                c.157-213  ttttgattgcattctaaatatttcaagaattgt  c.157-181

.         .         .         .         .         .           g.65194
gagatttttatcctcacctcagcgtccctcctataagaatagtcactgtggggcagtccc  c.157-121

.         .         .         .         .         .           g.65254
aggtgtaagggactgtgtcatctcagtggtcagtcccagggaaatcagccttatgggagg  c.157-61

.         .         .         .         .         .           g.65314
gctcctgccaccacccccagcacccctcatggtggcccaccctgtctgcttggtttccag  c.157-1


Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center