four and a half LIM domains 1 (FHL1) - 428 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.67801
gtaagtgcacaccccacgaacagcccaagtttgcctcctggtggccactttgatgtcatg  c.888+60

         .         .         .         .         .         .  g.67861
gccctgacctaaatcaaagaaactggttatgctgggaggtcggtgcgcgtcacagggcaa  c.888+120

         .         .         .         .         .         .  g.67921
tagcgtggtggcatgggaacgtggggtctttacatcagggaagcccttggccgggcttca  c.888+180

         .         .         .      g.67955
gcatcttctcaggtccttgagagccacagcaggg  c.888+214

--------------------- middle of intron ---------------------
               g.67956        .         .         .           g.67989
               c.889-214  ttgcggcggcatgggggacaatggcggcgtgggg  c.889-181

.         .         .         .         .         .           g.68049
gactgtgcacgatggagtggaggagggggtctgggagccaggcagacctggctcttgcgt  c.889-121

.         .         .         .         .         .           g.68109
gcttgtcggtctgtgagtggggcaggtcgtcattttatctctctgaatcgtggtttcctc  c.889-61

.         .         .         .         .         .           g.68169
acctgtattcattcagctgtttctcttgttttcttttcttttctttttttttccccccag  c.889-1


Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center