four and a half LIM domains 2 (FHL2) - coding DNA reference sequence

(used for variant description)

(last modified May 28, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_001039492.2 in the FHL2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering FHL2 transcript NM_001039492.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.44699
                 gtgcatctccttatatggtcaaatgacacggcggggtttctcga       c.-181

 .         .         .         .         .         .                g.44759
 gggcgggagctgcgcagcgctccactcggccggcagcggagccgcagccaccagccgccc       c.-121

 .         .         .         .         .     | 02   .             g.47091
 gcgccctccagccccgtccgggagtccccggcccgctgcggtgcc | tggctgagaactgtg    c.-61

 .         .         .         .      | 03  .         .             g.57257
 tcttcctggagactaggctggcattttgactttggg | gttgctgaaaagccaggagtcaaa    c.-1

          .         .         .         .         .         .       g.57317
 ATGACTGAGCGCTTTGACTGCCACCATTGCAACGAATCTCTCTTTGGCAAGAAGTACATC       c.60
 M  T  E  R  F  D  C  H  H  C  N  E  S  L  F  G  K  K  Y  I         p.20

          .         .         .         .         .         .       g.57377
 CTGCGGGAGGAGAGCCCCTACTGCGTGGTGTGCTTTGAGACCCTGTTCGCCAACACCTGC       c.120
 L  R  E  E  S  P  Y  C  V  V  C  F  E  T  L  F  A  N  T  C         p.40

          .         .         .       | 04 .         .         .    g.70064
 GAGGAGTGTGGGAAGCCCATCGGCTGTGACTGCAAG | GACTTGTCTTACAAGGACCGGCAC    c.180
 E  E  C  G  K  P  I  G  C  D  C  K   | D  L  S  Y  K  D  R  H      p.60

          .         .         .         .         .         .       g.70124
 TGGCATGAAGCCTGTTTCCACTGCTCGCAGTGCAGAAACTCACTGGTGGACAAGCCCTTT       c.240
 W  H  E  A  C  F  H  C  S  Q  C  R  N  S  L  V  D  K  P  F         p.80

          .         .         .         .         .         .       g.70184
 GCTGCCAAGGAGGACCAGCTGCTCTGTACAGACTGCTATTCCAACGAGTACTCATCCAAG       c.300
 A  A  K  E  D  Q  L  L  C  T  D  C  Y  S  N  E  Y  S  S  K         p.100

          .         .         .  | 05      .         .         .    g.76063
 TGCCAGGAATGCAAGAAGACCATCATGCCAG | GTACCCGCAAGATGGAGTACAAGGGCAGC    c.360
 C  Q  E  C  K  K  T  I  M  P  G |   T  R  K  M  E  Y  K  G  S      p.120

          .         .         .         .         .         .       g.76123
 AGCTGGCATGAGACCTGCTTCATCTGCCACCGCTGCCAGCAGCCAATTGGAACCAAGAGT       c.420
 S  W  H  E  T  C  F  I  C  H  R  C  Q  Q  P  I  G  T  K  S         p.140

          .         .         .         .         .         .       g.76183
 TTCATCCCCAAAGACAATCAGAATTTCTGTGTGCCCTGCTATGAGAAACAACATGCCATG       c.480
 F  I  P  K  D  N  Q  N  F  C  V  P  C  Y  E  K  Q  H  A  M         p.160

          .         .  | 06      .         .         .         .    g.80341
 CAGTGCGTTCAGTGCAAAAAG | CCCATCACCACGGGAGGGGTCACTTACCGGGAGCAGCCC    c.540
 Q  C  V  Q  C  K  K   | P  I  T  T  G  G  V  T  Y  R  E  Q  P      p.180

          .         .         .         .         .         .       g.80401
 TGGCACAAGGAGTGCTTCGTGTGCACCGCCTGCAGGAAGCAGCTGTCTGGGCAGCGCTTC       c.600
 W  H  K  E  C  F  V  C  T  A  C  R  K  Q  L  S  G  Q  R  F         p.200

          .         .         .         .         .         .       g.80461
 ACAGCTCGCGATGACTTTGCCTACTGCCTGAACTGCTTCTGTGACTTGTATGCCAAGAAG       c.660
 T  A  R  D  D  F  A  Y  C  L  N  C  F  C  D  L  Y  A  K  K         p.220

          .         .         | 07         .         .         .    g.82371
 TGTGCTGGGTGCACCAACCCCATCAGCG | GACTTGGTGGCACAAAATACATCTCCTTTGAG    c.720
 C  A  G  C  T  N  P  I  S  G |   L  G  G  T  K  Y  I  S  F  E      p.240

          .         .         .         .         .         .       g.82431
 GAACGGCAGTGGCATAACGACTGCTTTAACTGTAAGAAGTGCTCCCTCTCACTGGTGGGG       c.780
 E  R  Q  W  H  N  D  C  F  N  C  K  K  C  S  L  S  L  V  G         p.260

          .         .         .         .         .         .       g.82491
 CGTGGCTTCCTCACAGAGAGGGACGACATCCTGTGCCCCGACTGTGGGAAAGACATCTGA       c.840
 R  G  F  L  T  E  R  D  D  I  L  C  P  D  C  G  K  D  I  X         p.279

          .         .         .         .         .         .       g.82551
 attcaacacagagaagttgctgcttgtgatctcacacacagatttttatgttttctttct       c.*60

          .         .         .         .         .         .       g.82611
 cacccaggcaatcttgccttctggtttcttccagccacattgagactttcttctagtgct       c.*120

          .         .         .         .         .         .       g.82671
 tttcagtgatactcacgtttgcttaaaccctttagtgctttgtgatagttcagtcccagg       c.*180

          .         .         .         .         .         .       g.82731
 gaaagagaaaactcgccctaggccctaggtgggaagatggtttgaaatttttgtaatcga       c.*240

          .         .         .         .         .         .       g.82791
 gtaaggcacacccaaatgtaaaaatccttttgaatgatgcctttataaatctttctctca       c.*300

          .         .         .         .         .         .       g.82851
 ctgtctatttaagtgcaattaacatatgtcacgaacttgaaagttttctaaactcaataa       c.*360

          .         .         .         .         .         .       g.82911
 ggtaatgaccagttgttatttacagctctgtaacctcccgttgcgtcaagtctaaaccaa       c.*420

          .         .         .                                     g.82948
 gattatgtgacttgcaataaagttattcagaacagaa                              c.*457

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Four and a half LIM domains 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center