fumarate hydratase (FH) - downstream reference sequence


         .         .         .            .         .         . g.27227
attgacttgtattatagttgaatctatgata / tttgtgcatgttgtctttgtgacttcata c.*300

         .         .         .         .         .         .    g.27287
agttaccaatttctaaagggttttaattttggaggttattggtggtttaaaaaattgccc    c.*360

         .         .         .         .         .         .    g.27347
gattatatcttattatctcattcccaaactatgtccttagccatcttttattttcctttg    c.*420

         .         .         .         .         .         .    g.27407
atttggagacacagtgaccaagcccttttgagtggggatgtgtatatgtgtgtgtgtgtg    c.*480

         .         .         .         .         .         .    g.27467
tgcacgcacgtgtgtgtgtgtgatagaataggttaagaaaattgggacatacatatcctg    c.*540

         .         .         .         .         .         .    g.27527
tgtgttaaacacacacctatccctccaaccttgtttctgttaccacagagggaccagatc    c.*600

         .         .         .         .         .         .    g.27587
aaggccaggcatggtgggtcagggacaccgactttaggagactgcgctttgggaaactga    c.*660

         .         .         .         .         .         .    g.27647
ggcagaaagatcatttgagcctaggagtttgagaccagcctgggcagcataatgagatcc    c.*720

         .         .         .         .         .         .    g.27707
ctatctctacaaaaaataaaacaaaaattaggcaggcttggtagtgtgtgcctgtaatcc    c.*780

         .         .         .         .         .         .    g.27767
cagctactcaggaagctaaggtggtaggattccttgagcccaggaagttgaggctgcagt    c.*840

         .         .         .         .         .         .    g.27827
gagccaagattgcacccctacactccagcctaggtgacagagtgagaccctgtctcaaaa    c.*900

         .         .         .         .         .         .    g.27887
gaaaaaaaacaacaaaaagactgggttaagaattacaggacaagggttagaaagataaag    c.*960

         .         .         .         .         .         .    g.27947
ggagcaggcaggaagatgggaaggaaaggaaagatgtcctgaaagtgagtcttgttcatc    c.*1020

         .         .         .         .         .         .    g.28007
atctcaagtgctgagattcttcagcagaaattcatttgaaacaaccttaggggattttga    c.*1080

         .         .         .         .         .         .    g.28067
attagcagttatagggagatgcagaatagggtgacccaaatccaaagctaaggaatgtat    c.*1140

         .         .         .         .         .         .    g.28127
ttaaaatagagccaacctctactatgcagggagtcggaacaggcatttgttctatttttt    c.*1200

         .         .         .         .         .         .    g.28187
cttctacctcgtgtaataaataacaggatcataagaggaactctcattaactaaaacatc    c.*1260

         .         .         .         .         .         .    g.28247
tcatctgtaagtattactctatcaggtacattttaaaaaatgggatatttaccccctaat    c.*1320

         .         .         .         .         .         .    g.28307
attcttgggaaatcagtcacattaacaccaactcctctgtcgtagtttgaagtagttgct    c.*1380

         .         .         .         .         .         .    g.28367
ttatatagaatttaaaagcgtaatttaaaaagttctagaaacattgtgatgaaagatgaa    c.*1440

         .         .         .         .         .         .    g.28427
atttatatttttctaatttcttaagcgtgaatggtcactattaaaaggctgttcaaactt    c.*1500

         .         .         .         .         .         .    g.28487
taaaaactgaactatagagaacctataggatctactttttagctcatgcaatactgtttc    c.*1560

         .         .         .         .         .         .    g.28547
tgccagtgtttttcagagggcgatgcgatgatgcttgtgtagcttgctttaaaacaaagc    c.*1620

         .         .         .         .         .         .    g.28607
atgctttccgttggcacattctgtttggttttttttagaaaaagatttttattggaaaat    c.*1680

         .         .         .         .         .         .    g.28667
aaaatcaattagactgcatagctatgcctggaccccgacaaccaaactggcaactgatct    c.*1740

         .         .         .         .         .         .    g.28727
gtagttgtgaaacagtttatccactatgatgctgaatgttttgccttagcaggcattctc    c.*1800

         .         .         .         .         .         .    g.28787
agtctaaataggctgtcatttgagggtcacgagagacacagtgacttatgtaataaagat    c.*1860

         .         .         .         .         .         .    g.28847
tatggcagatcaagttcctagcctcagacagtctttgcacagctgtctgatgtatcccag    c.*1920

         .         .         .         .         .         .    g.28907
catattatagggcatcatggaatcctttgagttggcagtcatctttgtgtgatgttagtg    c.*1980

         .         .         .         .         .         .    g.28967
aagtgaaaccgctttatgatgcaatctaaataaggcttgtagaattccctgttggagggt    c.*2040

         .         .         .         .         .         .    g.29027
tgttccgaaagtcaacttccatgttttttcgctaggggcaattttgtctcccaggggaca    c.*2100

         .         .         .         .         .         .    g.29087
tttggcaatgtctggagacatgtttggttgtcatcacagaggaggggggtgctactggct    c.*2160

         .         .         .         .         .         .    g.29147
ctaattgggcagaagccagagatgccgctaaatgttaatgcacaggagagcccctccgcc    c.*2220

                                                                g.29152
cacaa                                                           c.*2225


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center