fumarate hydratase (FH) - 2274 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5224
gtgagcgcaggccgccatcccccggcctccccgcagtgaccttcagccctcctgcctgcc  c.132+60

         .         .         .         .         .         .  g.5284
ggcctgggcgcccgcgacttggcgggagagattccccgggcgtccgggccgcgccagact  c.132+120

         .         .         .         .         .         .  g.5344
ctgggcttagcgcccgtgccggcgtggcgggcctcccggcctcgggacgcctcttccggc  c.132+180

         .         .         .         .         .         .  g.5404
gcagggatggagccgcagcccgggagagcgcttggggagggacgggggctgtcagagagg  c.132+240

         .         .         .         .         .         .  g.5464
gtcctactgggcccgctcccggcgcctcctcggagccgtccgtggcgggccgaggccggg  c.132+300

         .         .         .         .         .         .  g.5524
gcgttttgaggtaacttcgctgctgctggcgcgcaggcccccagccccggggcgctgccc  c.132+360

         .         .         .         .         .         .  g.5584
tcaaggacagtgccggcgtgggcggagggtgctgggagaggggcagctcccgcaccgtcc  c.132+420

         .         .         .         .         .         .  g.5644
tgccccatagctgggccttgctggccggacactggccgcctgtgcatctagtggtttctg  c.132+480

         .         .         .         .         .         .  g.5704
aactgtggtttgtttcgccaaggggcactgcactgctttcaggccctccaggtggggtag  c.132+540

         .         .         .         .         .         .  g.5764
aaggttcttcgaagattttacttcctttgaaattgcatgctcagtttgttaggctgacta  c.132+600

         .         .         .         .         .         .  g.5824
tggtttcccccgtaattgttgtaaaactcttcaattccgaataccgcgggcatagtgttc  c.132+660

         .         .         .         .         .         .  g.5884
tgaagcatgtttgagcagattggctaggagctgaatcggtactttttattcagaaagcca  c.132+720

         .         .         .         .         .         .  g.5944
gctaagaacttaaagatccaagttcaggttatgacatgcttacgtaagtcattttgctct  c.132+780

         .         .         .         .         .         .  g.6004
ttagagtgtcatctttaggaatgcaggcttttaaaaagctttaaatacatatgtatattg  c.132+840

         .         .         .         .         .         .  g.6064
ttaggaaacgtttgagaaatgatagttgaagagttacagttctgcactggtgtagcatga  c.132+900

         .         .         .         .         .         .  g.6124
ggtttgcaatctaagagatgtgatttcaaatccgtatgcaaagttgaaatacttacagct  c.132+960

         .         .         .         .         .         .  g.6184
actcagcaaaactgcacatgtgaaaataccatgtagcgagtgctcattaaataagtgccc  c.132+1020

         .         .         .         .         .         .  g.6244
catctagggtatttcaaagggccagtactttttctggactctaaacttcaagataatttg  c.132+1080

         .         .         .         .         .         g.6301
attgggtcactatacctacgatatacaactatactacagaatcagagatgttttgta  c.132+1137

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.6358
   ttcctcgaactccctgctcgaataattttagggcattttaaaacctttacatatttt  c.133-1081

.         .         .         .         .         .           g.6418
taaatttatttattgtttatttagtgttttgtaaagggaagcagactggagaacttctga  c.133-1021

.         .         .         .         .         .           g.6478
atctatcctgttgatgcaaatgtcaaaaaatagcagcactactttgctcttagaattgta  c.133-961

.         .         .         .         .         .           g.6538
atgttagctaaaatcagatggaggtagtttttgttttttctagttctggtactttttgcc  c.133-901

.         .         .         .         .         .           g.6598
ctctaaccattctcaggtccaaaatctctgttggttttgttaaaagttcttcctgttgct  c.133-841

.         .         .         .         .         .           g.6658
aatgttgagaatttcacataacccttgatgccctaaggtaccttttatttaaaagaacac  c.133-781

.         .         .         .         .         .           g.6718
atacaaattcattcaatagaaagatactgtttattgagtgccttccacttaccaggccct  c.133-721

.         .         .         .         .         .           g.6778
gtaaataagacagtccctatggggatagggttttacaggcagtgttttattcttgtcttt  c.133-661

.         .         .         .         .         .           g.6838
agtggagattaaataagcaaagcagttaaataagcaaataaatcacacatgaataattag  c.133-601

.         .         .         .         .         .           g.6898
tgtgatcattgattattaaaaatgcattaaaaagtgcattgagaatgagaatatttaaca  c.133-541

.         .         .         .         .         .           g.6958
ggcagaccaactgtgatactgacttggtagcatgatggcatatatatagtgtttatatat  c.133-481

.         .         .         .         .         .           g.7018
gtaaataatgtttatacatttcttatataaatgaatatacatatgtaatatatgtgaata  c.133-421

.         .         .         .         .         .           g.7078
atgtttatatataaataatgtttataaatttcaaataatcattcttagaccgttttcaaa  c.133-361

.         .         .         .         .         .           g.7138
agttcccagtaaaataagcattaaactaagtacattgaattggccaaatcttgaccagta  c.133-301

.         .         .         .         .         .           g.7198
ataagcatactcttgaaatggaaaagattactatttgtatttcaaagtctttatgtttat  c.133-241

.         .         .         .         .         .           g.7258
caccagcatagtatattagttctacagtctgtctttaaagcctgaattaataagtttgtg  c.133-181

.         .         .         .         .         .           g.7318
tgacaaagagctctcaaggaaagacctgaaagtgaggaagagaatgagaatccaaatagt  c.133-121

.         .         .         .         .         .           g.7378
atttttttgtctttgtgatacttattcaggtttctttctctttaacagctgataagatgc  c.133-61

.         .         .         .         .         .           g.7438
gattacttttgatcctgggtttcttttcaacttgtaatagtgttgtattcttgtctttag  c.133-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center