fumarate hydratase (FH) - 3468 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.7633
gtaagtggcatttgtggaaatgttggctattttggatgaagtaggctgtattcatgagtc  c.267+60

         .         .         .         .         .         .  g.7693
actttactttataaatatttttcagagttaaaatgtaaagttattagaaaagatggcttc  c.267+120

         .         .         .         .         .         .  g.7753
gtgagtaataagaggttctctttcactaaaatgttaaagaactttttgaagttttagcat  c.267+180

         .         .         .         .         .         .  g.7813
gctattattttgagccatcgctttgaatattttggattttttaaaatttaaggccgggca  c.267+240

         .         .         .         .         .         .  g.7873
cggtggcttatgcctgtaatcccagaactttgggaggccaaggtgggcagatcacgaggt  c.267+300

         .         .         .         .         .         .  g.7933
caagagatcgagaccatcctggccaacatggtgaaactctgtctctactaaaaatacaaa  c.267+360

         .         .         .         .         .         .  g.7993
aattagccgggcacggtggcgcgcgcctgtagtcccaattactctggaggctgagacagg  c.267+420

         .         .         .         .         .         .  g.8053
agaattgcttgaacccgggaggcggaggttgcagtgagctgagatcgcaccactgcactc  c.267+480

         .         .         .         .         .         .  g.8113
cagcctggcgacagagtgagactccgtctcaaaaaaaaaaaaattaatttaattttaagt  c.267+540

         .         .         .         .         .         .  g.8173
tccgggatacacatgcaggatatgcagttttgttgcataggtaaatgtgtgccatggtgg  c.267+600

         .         .         .         .         .         .  g.8233
tttgctgcacctctcaacccatcacctagatattaaaacccggcattagctattttttct  c.267+660

         .         .         .         .         .         .  g.8293
gctgctccccctccgcccacaggcccctgtgtgctttgttcccctccttgtgtccatatg  c.267+720

         .         .         .         .         .         .  g.8353
ttctcattgttcagctcccacttacaagtgagaacatgcgggtttggttttctgttcctc  c.267+780

         .         .         .         .         .         .  g.8413
tgttagtatgctgagggtcacagcttctagctccatccatatctctgcaaaggacatgat  c.267+840

         .         .         .         .         .         .  g.8473
ctcattcttttttatggttgcataatattccatggtggatatatacaactttttctttat  c.267+900

         .         .         .         .         .         .  g.8533
cctttattgatggacatttgggttgatttcatgtctttgctattgtgaatagttattttg  c.267+960

         .         .         .         .         .         .  g.8593
gatttttatttggcagaactaaatgattgtcttttcactcttgctgggtatttacagatt  c.267+1020

         .         .         .         .         .         .  g.8653
tttactagggttctacagtttgtaaatatttttatttcaatactcattcttttttccccc  c.267+1080

         .         .         .         .         .         .  g.8713
actaatttaaaactgagattttttaaaattacactttgtattttggtttcagtttcctaa  c.267+1140

         .         .         .         .         .         .  g.8773
aaagtgtatagtacacaaacacatcaaagtattactcttaaccatgtctgacatataata  c.267+1200

         .         .         .         .         .         .  g.8833
gataatatataagtatttattcaattccatatgaatgattaaatgatgagaaaactttct  c.267+1260

         .         .         .         .         .         .  g.8893
accacattcaattaaatttaagatgccattaattagaagatgcaccaataggcaccacta  c.267+1320

         .         .         .         .         .         .  g.8953
agaaagaaaaatgctaccaattaaggttgtgacttaccattgattacaagatacatcttg  c.267+1380

         .         .         .         .         .         .  g.9013
atttcagagatgttaaagtgtgaaaagaattgagaaatgcataacatattctacgggagc  c.267+1440

         .         .         .         .         .         .  g.9073
ccaaccggagtatgaaaaatagtcaatgcaggataggctagtaagcctagaagtagatag  c.267+1500

         .         .         .         .         .         .  g.9133
gcttcatcctgtgagatattgtttaacacttatcttataaatatgcttttattttcaata  c.267+1560

         .         .         .         .         .         .  g.9193
attttaagtcattcctaagccttcaagactgcctcttgacaggtatatagaactttacaa  c.267+1620

         .         .         .         .         .         .  g.9253
caggcagctgaatctttgatgagaatatctttgtcattgccatctacagccttcttggtg  c.267+1680

         .         .         .         .         .      g.9307
gtgaggtaaacatagtttgactacgtggttaggtgaaaaagggtagtgaccaat  c.267+1734

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.9361
      cctaaaataatctcatattattcaactccagagactaaggaggaggtcagcccc  c.268-1681

.         .         .         .         .         .           g.9421
agctagtgttggtgggagtgagcatggctgccgttttcattgatctgtgtcaccagcatg  c.268-1621

.         .         .         .         .         .           g.9481
ttttgtggttctggtggggcatggttcctgctgctgctgctccagagacagcacagccat  c.268-1561

.         .         .         .         .         .           g.9541
tgggattgcacacctgtgaaaggcagacacctggggtctcgattttgtcatactttctga  c.268-1501

.         .         .         .         .         .           g.9601
actttattatgtgtaaaacagtctgtatgtactctaaactgagtagtatgattaaactca  c.268-1441

.         .         .         .         .         .           g.9661
accctttttacttgaggtccagaggaaaacaaagctaaaaagattatgaacatctaatgt  c.268-1381

.         .         .         .         .         .           g.9721
gaataaattaagaataaagtgacctgtcttttctctctagtgatacattttgccatttta  c.268-1321

.         .         .         .         .         .           g.9781
tggtgttcgttgaacctctttctgctgtgaatgacccttttttatttttatggtccataa  c.268-1261

.         .         .         .         .         .           g.9841
acactgggggtcattcactccattcagatggccagcgttgattggcattcacctttgccc  c.268-1201

.         .         .         .         .         .           g.9901
ttggtagtggttcagcccactacctcagtgtttgttactgtggagatttaaattcccatt  c.268-1141

.         .         .         .         .         .           g.9961
tgtttttgtgtttaaagtttttaagtttctaatcctgtgtgccatctgtcctcatttcgt  c.268-1081

.         .         .         .         .         .           g.10021
ttgagtcaaacgtttctaatgttttaattttagttacttaaaattgaaatttcaaatttt  c.268-1021

.         .         .         .         .         .           g.10081
ctggttttccttttctatttgaccctcagcttatacttactctggtccaggtttatgttt  c.268-961

.         .         .         .         .         .           g.10141
ttaatgtgtcttatttcttacttttcttggctttttctactttgattccagagatagcag  c.268-901

.         .         .         .         .         .           g.10201
gttctctcttatacattcatcattctcttcctttcttccctttctcccttctactctttc  c.268-841

.         .         .         .         .         .           g.10261
cccattcaaacctggtgtgggatctatacaacaatctgtattattaattttgacaagaac  c.268-781

.         .         .         .         .         .           g.10321
tcacaattcacttgtcttataaaaactaggttttcatttcagtttatccttttcaagctt  c.268-721

.         .         .         .         .         .           g.10381
ggtgaggtgatttgggatagacaatgaaaatatctgcattaatggggttttatatatatc  c.268-661

.         .         .         .         .         .           g.10441
ggaagctgtcacctttaggtctggagaatcttgggtttaaaaaaataattcttctgagag  c.268-601

.         .         .         .         .         .           g.10501
aaatgtccagggagttactgagtattaaggctttactagctaagtagaatagattgcttt  c.268-541

.         .         .         .         .         .           g.10561
ttggccttggggtgaaatgataacccagtcagtcactggtagtctcatactgattggcag  c.268-481

.         .         .         .         .         .           g.10621
ttaaatatatcccttatttatttatttttttaagaggggaaggaaacaattataatgtaa  c.268-421

.         .         .         .         .         .           g.10681
cgtgggatccagtaagagaaaataatggttcttgctggtgaaaagattgagtactaaatt  c.268-361

.         .         .         .         .         .           g.10741
tgtttttatttatagtatatgaaataaacacatataatttattgtgtgtatttgtgcata  c.268-301

.         .         .         .         .         .           g.10801
ggattgtattcgtgtgaatatgtgtgtatatgtatgtgggagacgtacacacatatatat  c.268-241

.         .         .         .         .         .           g.10861
atgaagagtcaatgtatttgtttttatttggttccttaaacaaatagatctatgataatg  c.268-181

.         .         .         .         .         .           g.10921
ttgattcttggttcatgaattcctgtctataatctttctctataaccgaaacattttaga  c.268-121

.         .         .         .         .         .           g.10981
gctatagtgttactgttttattgttattgttttatgtatagcttttgcatctgccaaaat  c.268-61

.         .         .         .         .         .           g.11041
aataaacttccatgcttaagtaaaattgtaaatttgaaatatttttctgattaattttag  c.268-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center