fumarate hydratase (FH) - 1459 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.11212
gtaggaggtgataagtgtgtttgcttaataacctcagacccatgccatactctggatgac  c.378+60

         .         .         .         .         .         .  g.11272
gatatgctctggcagaaggaaaggggaactgtgaattcttgaattaatgaatttcagggg  c.378+120

         .         .         .         .         .         .  g.11332
agggtggtagcattatttttagtggtgatattaatatggtgcttaaaacgttacattgtg  c.378+180

         .         .         .         .         .         .  g.11392
acaaaatttctggatgattttataccttttgtttttaagccttttgactttccttaattt  c.378+240

         .         .         .         .         .         .  g.11452
atatagttttaagaaaattttttgaaaagatatcatttgaactttacttgattttttatt  c.378+300

         .         .         .         .         .         .  g.11512
ttatatataaatctttttaaaaccagttgattatttgataatgcatattgagaatgtaat  c.378+360

         .         .         .         .         .         .  g.11572
tttactaatatgctaataacattgtcttaaagaagcaatcagaggtaacagaactgtata  c.378+420

         .         .         .         .         .         .  g.11632
tatagtgttgttaattacagcactatttataataatgaaaacaaattagacaatgcgtaa  c.378+480

         .         .         .         .         .         .  g.11692
ctataacagctacttatataaattatatttatatggtaaattatagaaaattactttttt  c.378+540

         .         .         .         .         .         .  g.11752
gaagattggcatgcacaaagcctagcctatgagaaatagggaggaaagtttgcaaaaata  c.378+600

         .         .         .         .         .         .  g.11812
tatgtattttacgatcctaattttgtttaggaaaaaatgaacagaaagtgtgtgtttctc  c.378+660

         .         .         .         .         .         .  g.11872
atatacacacacacacacacacacacacacaccctcattgcatgagatagagactgggga  c.378+720

         .  g.11882
tgccaacatg  c.378+730

--------------------- middle of intron ---------------------
                                        g.11883               g.11891
                                        c.379-729  ctaatagtc  c.379-721

.         .         .         .         .         .           g.11951
ataattactgagcaatagaactatagtgactgttttacttttctcagttctcaaaatttt  c.379-661

.         .         .         .         .         .           g.12011
ctacactaatcacatatttttatataaccagaaaaaagttttattttaaagtggaccagt  c.379-601

.         .         .         .         .         .           g.12071
tgttcaaggtaatagatttctcaagtgcattctgattttttaagctaaaatcattccaga  c.379-541

.         .         .         .         .         .           g.12131
agattgttaaccacccatattttacaaagcacaccatccaaaaactaacacataagctgg  c.379-481

.         .         .         .         .         .           g.12191
atgtataaaaatacaacaaaaataggggcaaatctgggcagcgtttatttctacatttgg  c.379-421

.         .         .         .         .         .           g.12251
tgattactgctcattggacatctgtgcaatgaagtagctattagtgaactcacattttca  c.379-361

.         .         .         .         .         .           g.12311
agttactagctcattagcatgctgactctggcaataacatctgttggatattcctgctga  c.379-301

.         .         .         .         .         .           g.12371
gcaccagcaacaaatatatctagagactaaacgtatttgccagccttaacaggtggtcct  c.379-241

.         .         .         .         .         .           g.12431
ctgttagaggaggctgtgggagagagataagaaagatacctttgattcccttttcatttg  c.379-181

.         .         .         .         .         .           g.12491
aaaccagtgaattgtcataccattcactatagataatatttcactttttaaagtatctgt  c.379-121

.         .         .         .         .         .           g.12551
ggttggagcaagtgatgcttcagaagcttagatatgtgggtcaactgtattcaaactctg  c.379-61

.         .         .         .         .         .           g.12611
tggcataatcagcattattatttccttttttaaaatacatttttaacattttttctgcag  c.379-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center