fumarate hydratase (FH) - 3181 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.12848
gtcagtatgtgagctttgctgttttttggttataaattgaaaagcatacctgagattgtt  c.555+60

         .         .         .         .         .         .  g.12908
cttgtaaaacaagcattcactttttgacaagaagtgttcattatttaatggataaggctt  c.555+120

         .         .         .         .         .         .  g.12968
cttatggttcttatttcttgaaggaatcttggttttatgtttcaatccttataaaaatta  c.555+180

         .         .         .         .         .         .  g.13028
tttttaggacacctgaatttagtgtatgtatttttttattgtttaaaactctattttgaa  c.555+240

         .         .         .         .         .         .  g.13088
ataattttagatttataagagaattgcaaagatagttcaaatagtttctatatcccttca  c.555+300

         .         .         .         .         .         .  g.13148
ctcagcttcccttattgttaacatcttatgtaaccatggtacatttatcaaaactaagaa  c.555+360

         .         .         .         .         .         .  g.13208
attaacatagatacagtactcttagctaaacaacagactttaaaaaaaaaacaaaaaact  c.555+420

         .         .         .         .         .         .  g.13268
gaggctttcctcagtttttccactcatgttctttttcaggatccaatcaatgctatacat  c.555+480

         .         .         .         .         .         .  g.13328
tacatttagtcacatgtccccttggtttcttctaatctgtgacagtttcttggtcttttg  c.555+540

         .         .         .         .         .         .  g.13388
cgattgtctcagtcctttggggctgcagtaataaaatacaatagactgactggcttataa  c.555+600

         .         .         .         .         .         .  g.13448
acaatagaagaagttaatttgtcacagttctggcagctagaagtccgaggtcaggccact  c.555+660

         .         .         .         .         .         .  g.13508
ggccaattcattggcttggtgggggcccactttttggtttgtagatggccatcttttctg  c.555+720

         .         .         .         .         .         .  g.13568
tgtcctcacatggtagaagggacaagggagctctctggggtctcttcgtaaggacactaa  c.555+780

         .         .         .         .         .         .  g.13628
ttccgttcatgagagctttgccctatgaactaatcaccttgcaaaggccgcatctcctaa  c.555+840

         .         .         .         .         .         .  g.13688
tactattaccctaggggttaggatttcacatagcagtgaccttgacactttgaaagcagt  c.555+900

         .         .         .         .         .         .  g.13748
ggtcaggtattttgtagaatgtccctcaattctggtgtgtctgacgttttctcattagat  c.555+960

         .         .         .         .         .         .  g.13808
tgagacttttgaatttttgagaaaactatcacagaaataaagggcccttctcattgcatc  c.555+1020

         .         .         .         .         .         .  g.13868
atatcaggggttcatgatagcaacatgacttttactggtgatgttaaccttaatcacttg  c.555+1080

         .         .         .         .         .         .  g.13928
gttaagctggtacttgccaggtttctccatggtaaaattataatttttcctcttctatac  c.555+1140

         .         .         .         .         .         .  g.13988
cctgttcattagaaataggtcactaaaccctgcctgcattccaggcactgtatttcagtt  c.555+1200

         .         .         .         .         .         .  g.14048
tctagagggaggagtatcaaaaagtttttgggcttacattaaaatcactgtagtaattaa  c.555+1260

         .         .         .         .         .         .  g.14108
tagcgcgctaccttgaggctaggcaaacatcttctttttccttaaactttttcctactat  c.555+1320

         .         .         .         .         .         .  g.14168
ttttagcattcatcagggaatcttatctacagcaattacttccatggtgttttaatagtg  c.555+1380

         .         .         .         .         .         .  g.14228
attttcagttttctttattcattctacacttgttagttgaatttttctgcaaggaagatt  c.555+1440

         .         .         .         .         .         .  g.14288
tgttctctctgtcccatttatttatttattcagttatttgggtatatcagtatggactga  c.555+1500

         .         .         .         .         .         .  g.14348
tggttatttattttattcttcaggttatgatcccatacttttgtttatattgttgcttaa  c.555+1560

         .         .         .   g.14379
attctttcagctctgggaacccaattcattt  c.555+1591

--------------------- middle of intron ---------------------
                  g.14380     .         .         .           g.14409
                  c.556-1590  ggctcttgtgtccttttaggcatgccacca  c.556-1561

.         .         .         .         .         .           g.14469
tccttttacttttctgaagtgtgttccgacttcctggtactttaagatgctccaagctca  c.556-1501

.         .         .         .         .         .           g.14529
ttgtcttgtattgtttctgccccagccctagaaacagccatttttcaaggaactgttgga  c.556-1441

.         .         .         .         .         .           g.14589
gaattcttattggaaaatgatatttagaaactgagatctgggtgctaagtataatttaat  c.556-1381

.         .         .         .         .         .           g.14649
atatttttaagtagtaaggaagaagtgtttttaatacacgttcattgtataagggatttt  c.556-1321

.         .         .         .         .         .           g.14709
cccaatctaatacttgcctttatgaatttatgttctatatatactgaagtctgaagtctg  c.556-1261

.         .         .         .         .         .           g.14769
cctcagaaaggtagagttatagatgaaacgtgattggctacatgttgataattatgtaaa  c.556-1201

.         .         .         .         .         .           g.14829
ctatttgaattcaggtgacaggtacataagtgtttattataccattcatcctacttcttt  c.556-1141

.         .         .         .         .         .           g.14889
cgtaagtactttatattttgcatagtaaacgtcaaaatatataaataatgtatcttttta  c.556-1081

.         .         .         .         .         .           g.14949
aatgacagtatacttttatatatatctgtgtgtgtgcatgcgtgtgtgtgtgtgtgtgtg  c.556-1021

.         .         .         .         .         .           g.15009
tgtgtgtgtgtgtgtgtgtgtgtgtgtttagagattgtgcttcactctgtcacccaggct  c.556-961

.         .         .         .         .         .           g.15069
ggagtgcagtagagtgagcatagctcactgcagcctggaaatgctgagctccagggatcc  c.556-901

.         .         .         .         .         .           g.15129
tcatgccttagcttcctgagcaagtgggaccataggcatgcaccgccatgcctggctaac  c.556-841

.         .         .         .         .         .           g.15189
tttaaaaatgttttcagagacagggtattgctctgtgttgcccaggctggtcttaaactc  c.556-781

.         .         .         .         .         .           g.15249
ctggcctcaattgatcctcctgcctcagcctctgaaagtgctgaggttataggcatgagc  c.556-721

.         .         .         .         .         .           g.15309
cactgcacccagcttgatattatgttttaaaagtacagggtcaacagttgaggaaagagc  c.556-661

.         .         .         .         .         .           g.15369
actgagtatatactacctggctaggtctcaggtttgccagttgctaaatattttggcatt  c.556-601

.         .         .         .         .         .           g.15429
tatacagtctctttgagggcttggctttcctatttttaaagtggtaatctacctcacaga  c.556-541

.         .         .         .         .         .           g.15489
atttttctaaacttaataaagagctgtttatgaaagactgtatgcactgtataattgtaa  c.556-481

.         .         .         .         .         .           g.15549
gatattcaattataagattttataagaatatataattcaataattgatgtaatttgatat  c.556-421

.         .         .         .         .         .           g.15609
aattataagatattcaactacattgaagatactactgctgtcttcaagtgcagttgttaa  c.556-361

.         .         .         .         .         .           g.15669
ctatacttctctgtattttgctgtcatttattagcaggcagatataatacgtaatacata  c.556-301

.         .         .         .         .         .           g.15729
atataatacataatatattatataatacataatataatataatacgtaatacatatataa  c.556-241

.         .         .         .         .         .           g.15789
tacataatacattcagtatacttaatgtgtataatacagttctgagtatgtgttagaaac  c.556-181

.         .         .         .         .         .           g.15849
caggatgctgcttatttgattctataataactcacctatgacatgccacacatacatgta  c.556-121

.         .         .         .         .         .           g.15909
actgagctgggttttgagtagttagttggagagttttttaattgagaagtttaattcaga  c.556-61

.         .         .         .         .         .           g.15969
agtttgtttttgttgcctctgatttaacattttatatttcttttgaaaaatttccaacag  c.556-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center