fumarate hydratase (FH) - 2434 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.16212
gtataggagtttgactaatttgattcaatttagagcttggtacaaatggccaatgtgtca  c.738+60

         .         .         .         .         .         .  g.16272
tccttgaaatctgactagcttaaaaggccaaatttgtaaccggaaacttcagtgacagag  c.738+120

         .         .         .         .         .         .  g.16332
gttgttctgttcaaccaatcagtaattttcattgacatccacttagaagaaaagcagagt  c.738+180

         .         .         .         .         .         .  g.16392
atactggctataagtcagattcagtcagactgctcgggttcaaatcttagctttgctgtg  c.738+240

         .         .         .         .         .         .  g.16452
tacaagctatgggaccataggaaagtcatttagcctttctgtgcctcagttttctgagct  c.738+300

         .         .         .         .         .         .  g.16512
acaaaatgaggaaaataatttccctttcataggatagttgtgaagctctagtaagttgat  c.738+360

         .         .         .         .         .         .  g.16572
ttatgtagagtgcttagaagcatgcctggcacacagtaagtacccattcatgttagctac  c.738+420

         .         .         .         .         .         .  g.16632
catcatcaccaccgtcatcgctgtcatctccatcagtatcatcatggtttttcttttgtc  c.738+480

         .         .         .         .         .         .  g.16692
tttcttacctaaattagtaggttatttaaaatttaatctcaaagtgattaaataaggtag  c.738+540

         .         .         .         .         .         .  g.16752
atctttttaagatggatctggccgcatgtgaaggagatactactctcttctccaagatat  c.738+600

         .         .         .         .         .         .  g.16812
tagaaagtattttcatgtttctttttcaatgccttaaggaatatctaatagtatacattg  c.738+660

         .         .         .         .         .         .  g.16872
tgaaggaaatgtaaggaaatacagggaatgacttttgtcttagtaaactcacactccaat  c.738+720

         .         .         .         .         .         .  g.16932
tggggtagcttaatttccttatggaaggaatgaggaaaacttgaaatgagtaattgaaaa  c.738+780

         .         .         .         .         .         .  g.16992
acaaatgatgggactaaattgaactcactggattgagttgcttcttaaggctgtgtctca  c.738+840

         .         .         .         .         .         .  g.17052
tttctctttgcatcattagtacttaggaccatgcataatttctaaggaggaacagtatgt  c.738+900

         .         .         .         .         .         .  g.17112
atgttttgaaacttttgaatatttctcaagtttctaattttaacctttttttggtgttga  c.738+960

         .         .         .         .         .         .  g.17172
aaactacaatactaaataccatttgggccatgactcagcctcctgtgtaaaatcatcatt  c.738+1020

         .         .         .         .         .         .  g.17232
cttcctgttaagacagaaaattacatttttctgtttgactttatcagaagcatttatact  c.738+1080

         .         .         .         .         .         .  g.17292
tgcttttattgggattgtcttttgagttcgtgcattgttccctgtcaaagtgtattttat  c.738+1140

         .         .         .         .         .         .  g.17352
aagtgaatctatctagtgtgtttgtgtgtgtgtgtatacatacagtcatgtgttgcttag  c.738+1200

         .         g.17369
caatgggggtatgttct  c.738+1217

--------------------- middle of intron ---------------------
                               g.17370            .           g.17386
                               c.739-1217  gaaaaatgcatccttag  c.739-1201

.         .         .         .         .         .           g.17446
gcaatttcatagttatgtgaacatcacagagtatactcacacaaacctagatggtatagc  c.739-1141

.         .         .         .         .         .           g.17506
cttctatacacctaggctatatggcatagccttttcctcctaggctacaaatctgtgcag  c.739-1081

.         .         .         .         .         .           g.17566
catgttactgcattggatacaataggcaatcgtaacacaatggtaagtatttgtgtatct  c.739-1021

.         .         .         .         .         .           g.17626
aaacatatctaaatgtagaaaaggtacagtaaaaatacggttttataatcttagggtccc  c.739-961

.         .         .         .         .         .           g.17686
actgtttatgtgatctttcgttggctgaaacatcattatgtggtgcgtgactgtatatga  c.739-901

.         .         .         .         .         .           g.17746
gtgatgttatatcagatgcatcaggtctacctataatgagttatatcttttgaaatgttt  c.739-841

.         .         .         .         .         .           g.17806
tctttagaacagtatggcatcctgtcacttatggttttttagtgttttcaggcaggaaaa  c.739-781

.         .         .         .         .         .           g.17866
aaggatagatttagtgtaaccatgtatcttggtttgtccagttaactcccagtgtatgcc  c.739-721

.         .         .         .         .         .           g.17926
ttttgtttctgcatgactattaatagagccctttctgtgttcaaaacataaattctgtgg  c.739-661

.         .         .         .         .         .           g.17986
ttgctttaattaaggcatgtcaaaatttggaaccagtgttgacattggcacattgatgct  c.739-601

.         .         .         .         .         .           g.18046
atgatctgactctaccgttacctcctattctttttggaaggtccttcaatgcaaactgtt  c.739-541

.         .         .         .         .         .           g.18106
accttcctgtgctattcagtgagtcattagcttcccaagtctctgtagaatgtcttcata  c.739-481

.         .         .         .         .         .           g.18166
tttcctggtaggtttatacactgaaattgtatggagaatatttctatgtttgcatttttt  c.739-421

.         .         .         .         .         .           g.18226
tgggggagatgagttactattttttcttacaccaaagttgtctgaggcatcccaaaaaat  c.739-361

.         .         .         .         .         .           g.18286
aagaaatcacttcagtttctttagtagactgcaagtaaaccaataatttagtgtagtaaa  c.739-301

.         .         .         .         .         .           g.18346
gttgttctttttaaagtgtatttcctgtgctgtttttctttgcttcctattaaaagacta  c.739-241

.         .         .         .         .         .           g.18406
gattataataaataggctgcatgttatcagtggcattgtcgtaccttatggttctataaa  c.739-181

.         .         .         .         .         .           g.18466
ccctcatccttccctatactttgctcatcataagatttgaagtagtataaataaaacttg  c.739-121

.         .         .         .         .         .           g.18526
attagcttgtaatttagtattctgaaaggtatttttaaaaatttctatttaatgcagtta  c.739-61

.         .         .         .         .         .           g.18586
gagtaacttgtaagctattaggaattacttattcttaccttaattttcttttcttttcag  c.739-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center