fumarate hydratase (FH) - 1757 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.18812
gttagtgatcacgtgaattatttctcattttcatttctcattatacgtggtctgtacatt  c.904+60

         .         .         .         .         .         .  g.18872
ttctgagtgttcctgtcttgaattcttgtgaatttaaagttagaaatgatatttttccat  c.904+120

         .         .         .         .         .         .  g.18932
caaacatgtgttttaagtatatttctgaagttataatgttaattatttgccttttaaaaa  c.904+180

         .         .         .         .         .         .  g.18992
atgttccatgtaggagtttatacagcatgccattaaaatctaccagtgttagctttgttt  c.904+240

         .         .         .         .         .         .  g.19052
actagttagttttcaattaatttccctttaaagttttgaatagcagttttcaaaataggc  c.904+300

         .         .         .         .         .         .  g.19112
agaaaaaactgagtgttgagtaagttatttgaatagtaaatatgttgtagacagacttaa  c.904+360

         .         .         .         .         .         .  g.19172
tttcttttttttcctattatgtcatgctgtgataattctttgaattattgacctttttga  c.904+420

         .         .         .         .         .         .  g.19232
accatgtctttcctttagtagagagagtattatactttagataatgataactattattag  c.904+480

         .         .         .         .         .         .  g.19292
ggccaagttgtcatcttcagaaaactctcattaagatgtagatgttaccagacggttagg  c.904+540

         .         .         .         .         .         .  g.19352
gtagagataattatacactgcacatgatagcttaccagctgatttgtctttaaaccatat  c.904+600

         .         .         .         .         .         .  g.19412
tttaatagaaaagaactctacttttagggtttggcaaatgtagatttataaaatttttaa  c.904+660

         .         .         .         .         .         .  g.19472
catgggggttaactgagaacatctaactcattttagcacactgtttttataggggatctt  c.904+720

         .         .         .         .         .         .  g.19532
gtgggctcctggctaggggagaggatgaagcacagtaaagtggacaaagaaactttaaaa  c.904+780

         .         .         .         .         .         .  g.19592
aattgtattaggggccggacatgggggctcacacctgtaatcctagcactttgggaggcc  c.904+840

         .         .         .           g.19631
aagatgggcagatcacttgaggtcaggagttcgagacca  c.904+879

--------------------- middle of intron ---------------------
           g.19632            .         .         .           g.19669
           c.905-878  gcctggtcaacatggcgaaaccctgtctctagtaaaaa  c.905-841

.         .         .         .         .         .           g.19729
tttaaaaaaattagccgggcatggtggcgggcgcctgtaaccccagctacttgggaggct  c.905-781

.         .         .         .         .         .           g.19789
gaggcaggagaattgctggaaccctggaggaggaggttgcaatgagccaagatcgtacca  c.905-721

.         .         .         .         .         .           g.19849
ctgccctccagcctggctaaaaaagcaagactctgtctcaaaaaaaaaaaaaagaaaaaa  c.905-661

.         .         .         .         .         .           g.19909
ggtattaggaaaggagtgtggtataaaccagaatgaattcccatatactttttactcaag  c.905-601

.         .         .         .         .         .           g.19969
catagtcaggcatcatatacgtgtgtttgcagtaggattgtgttttttctttcagtacat  c.905-541

.         .         .         .         .         .           g.20029
ttatcatacttgttatttcatctttttaaaatgtagtgcctggctaagcacagtggaatt  c.905-481

.         .         .         .         .         .           g.20089
acactcctgtaattccagcacttcaggagaccaaggtgggtggatcgctagagcctagga  c.905-421

.         .         .         .         .         .           g.20149
gtttgagaccagcctgggcaacatggcgaaaccccatctctactaaaaattaaagaatta  c.905-361

.         .         .         .         .         .           g.20209
gctgggcgtggtggtgtgcacctgtagtcttagctactctggaggctgaggtgggaggat  c.905-301

.         .         .         .         .         .           g.20269
tgcctgagccatggaggttgaggctacagtgagctgtgattgagccacactgcactccag  c.905-241

.         .         .         .         .         .           g.20329
cctgggcagcagagtgagaccctgtctgaaaaaacttaaaaaatgtaataccagattctt  c.905-181

.         .         .         .         .         .           g.20389
tctactcctttaggacttcttttaaaaatgtagacaaaatttgagtcttaagtaaacatt  c.905-121

.         .         .         .         .         .           g.20449
tttttctgaagtaaaatttttattttttcgtatattggaactttctgtttcacttgctaa  c.905-61

.         .         .         .         .         .           g.20509
tggtagaaaaatgtttagtttaacttgttcacccatctaggatatttttcttttctttag  c.905-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center