fumarate hydratase (FH) - 1471 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.20773
gtaatcacatagctagtaaatgttggagctaaaacttgactaggtcctaggcattcttag  c.1108+60

         .         .         .         .         .         .  g.20833
ctatggaccatgtctctctttgtttaaagttatcccgcagctggatgcgcaaggcgcact  c.1108+120

         .         .         .         .         .         .  g.20893
gttccagcatgtctgtggtcctctggtcaggactgctgggcacgtcacctgacaagatag  c.1108+180

         .         .         .         .         .         .  g.20953
gaagaaagaatctgacttagcagcaagtatttcgaatcccacattagaaaatgtagagca  c.1108+240

         .         .         .         .         .         .  g.21013
ggctgttaaagtgatcagcgcgggttgaataaaaagaagtcataccaaacttcacttatt  c.1108+300

         .         .         .         .         .         .  g.21073
tcattttttgcattccgttatatgcctgttagatatagcaagtgacacaacagtgtatgt  c.1108+360

         .         .         .         .         .         .  g.21133
ctggatttcagcaagtcatttgatagattcgcatgatagtcattgattccagtggagaag  c.1108+420

         .         .         .         .         .         .  g.21193
cgtgggcagtgctggcagatgaatgtagctgggtgaacagtgacatttcagaagtgacta  c.1108+480

         .         .         .         .         .         .  g.21253
atgaagtgacttcagtctagaagaatatattggtaacaagctgaagggctctgcccttca  c.1108+540

         .         .         .         .         .         .  g.21313
acactttactggtgactgagggtgaaggaagagaatacatgctaatcatattaacagtta  c.1108+600

         .         .         .         .         .         .  g.21373
acaaagttgggatagcaatactatggatgacagaactgagatccataaaggccactgtag  c.1108+660

         .         .         .         .         .         .  g.21433
cttgggctaaaactgacaatgtaacttttaatagtgagaaaggcctgactctagattttt  c.1108+720

         .        g.21449
atggaaattatggatc  c.1108+736

--------------------- middle of intron ---------------------
                                 g.21450          .           g.21464
                                 c.1109-735  tgtagaataagaaga  c.1109-721

.         .         .         .         .         .           g.21524
gatgaaattttgttttaaagtacttcatgttgaagaatgacataaaggtttagttgattg  c.1109-661

.         .         .         .         .         .           g.21584
caaatccagggtgattgccaaaagaaagagaactgggggagtcacagataaaggcaataa  c.1109-601

.         .         .         .         .         .           g.21644
tccacccaataatctttccagtgtgttaacttgtactggtcagaggaatctgggttgttt  c.1109-541

.         .         .         .         .         .           g.21704
gattcaaacttggagcttgtccaaggagtgtgagcagggtagtggggttccagagactcg  c.1109-481

.         .         .         .         .         .           g.21764
tgataaataggaaaattttagcttagcatcaccttcccctaggaagcctcccatgtgtta  c.1109-421

.         .         .         .         .         .           g.21824
gtgaagggtcgcttttataagtgttctgatagcagcatacactactctgtatttacccct  c.1109-361

.         .         .         .         .         .           g.21884
tataattgccagctctttctccctagcctccaagttctgcgagggcagggcctgcatctt  c.1109-301

.         .         .         .         .         .           g.21944
tcttattcagtgttgtatattgagtgcctggctccataaatatgtatagaatgaatgaaa  c.1109-241

.         .         .         .         .         .           g.22004
atcatgaaggtggagaactatatttaatgtgtagttgtggctactcgttagcctttgaat  c.1109-181

.         .         .         .         .         .           g.22064
gattcattttgtggctacccatcccaccttccttggttggtttgtttcattaaattacac  c.1109-121

.         .         .         .         .         .           g.22124
tgatggttgggccttgctttattgtatatcttactctatttagtgaaattagatttcttt  c.1109-61

.         .         .         .         .         .           g.22184
attctcctgattatttgcataaatttagtctttactctgtcattggtggttttcttgaag  c.1109-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center