fumarate hydratase (FH) - 2466 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.24378
gtaagtgtttaaggaataataatatcattttgaatgcaaaattaaaaagctaaaccattt  c.1390+60

         .         .         .         .         .         .  g.24438
ttaagagacaagtggatcagtgtttgagaacagcaaatttcttttgaatatggttttagt  c.1390+120

         .         .         .         .         .         .  g.24498
aaaatctcaaaatatttgaaattgtgtggaaaggtactatataacttgtatggtgtcata  c.1390+180

         .         .         .         .         .         .  g.24558
gttctttcaaaactagatctattatgcctcattttatttgaaatgtatcgagaagtagta  c.1390+240

         .         .         .         .         .         .  g.24618
gttcaaacttattttgattttaatggaattcagacgccaaatattctatgcagaccattg  c.1390+300

         .         .         .         .         .         .  g.24678
gggaaggttatttgtaagaccttcagtgggtaatgtcactaggtggcactgctgattagc  c.1390+360

         .         .         .         .         .         .  g.24738
aacattgaatgaactcatttttctaccttccctagatctctacaatgctttaattttgtt  c.1390+420

         .         .         .         .         .         .  g.24798
gttttattcaattcagaaatggaaagttacaattaaaagaaaaagtttatgtattcattg  c.1390+480

         .         .         .         .         .         .  g.24858
cttatagtgaaagggaggaaggaaaatgcaaatattttgtctaaaaccatgctattgtat  c.1390+540

         .         .         .         .         .         .  g.24918
tataagtcttttttggaactgtaaatatttcattatgtagaatcaaacatacagatttgg  c.1390+600

         .         .         .         .         .         .  g.24978
gtagtagactgaccatagagatctccattaaataaactgtttacacttttgtagattttg  c.1390+660

         .         .         .         .         .         .  g.25038
aggcattatgttgcattatattatgatgtgttaaaagccttttacccattcttcctttct  c.1390+720

         .         .         .         .         .         .  g.25098
gctaagcagaggttaatatattttctgcctttctgttatagaacaagttatgattcactt  c.1390+780

         .         .         .         .         .         .  g.25158
atttggcataatatggctactgcttcttctataatcttgaactttcaaggcaaattttat  c.1390+840

         .         .         .         .         .         .  g.25218
attcctggtttcacatcaagctataattacagttttttaaaattagagctcatttgactc  c.1390+900

         .         .         .         .         .         .  g.25278
ttttaggtagctctgagcccagtatgatatcagttttttggtgtggcattgagattggta  c.1390+960

         .         .         .         .         .         .  g.25338
ataatgtttgatccatttaaaattatggtacatcaactacatctggaaaaacacaaaggg  c.1390+1020

         .         .         .         .         .         .  g.25398
gaacccagaggctcgtgtgagcagttttcatcagatctttacttcagaatgtgttaccaa  c.1390+1080

         .         .         .         .         .         .  g.25458
aactttaaattagaggtgtctcctaaagttgaatgattggcaaatctttattggaatcaa  c.1390+1140

         .         .         .         .         .         .  g.25518
cttattgtgacataaaaagaattgttagaggccatatgagaatgagatgggtcaacacca  c.1390+1200

         .         .         .     g.25551
cctcactagttgacttggtgtgagccttacaac  c.1390+1233

--------------------- middle of intron ---------------------
              g.25552         .         .         .           g.25584
              c.1391-1233  cctctgaatcatgggttccctatattctcatta  c.1391-1201

.         .         .         .         .         .           g.25644
tgtaccaggctggttgccaatagtgtcttgttggacttgacagctgaaatgcttagactt  c.1391-1141

.         .         .         .         .         .           g.25704
taaagccattattaaaataaaagtactggatatatattgatctcaagagtttaacatgca  c.1391-1081

.         .         .         .         .         .           g.25764
aattctttctcaaagcatttctgctttaagaaagatgcccttttcagtaaatggcatcaa  c.1391-1021

.         .         .         .         .         .           g.25824
taaatgccctttcagatcaataaatgcccttttcaacatatttagcattcacaaattcag  c.1391-961

.         .         .         .         .         .           g.25884
ttaagtaataaaagtaactatgcccatgctttcttttatagctgattaataattgcatat  c.1391-901

.         .         .         .         .         .           g.25944
tgacacatgccatcttattgatgatgtatactgcctcagcaagcttcttccttttggtca  c.1391-841

.         .         .         .         .         .           g.26004
tatttctctgatcttgttttttttctcccgcattggtttcattttcattcctgctttttc  c.1391-781

.         .         .         .         .         .           g.26064
ttcttgacatatatatatatatatatatatatatatatatatatatatatatatatgtta  c.1391-721

.         .         .         .         .         .           g.26124
agacagcttgcagaactgccctgcccccacttttattaatttgaaaagcaaataactctg  c.1391-661

.         .         .         .         .         .           g.26184
aagtaaacagtatgcctgtgatcttttgtgcagtctgtatttctgcccagactccctatt  c.1391-601

.         .         .         .         .         .           g.26244
tgtgtccctgtaatgtctgggaggaggccagggtatagaagccattgcagtggagagcca  c.1391-541

.         .         .         .         .         .           g.26304
catagagaagagccattggaagcagctctggaggcacccctccccaggccctgcctgcgc  c.1391-481

.         .         .         .         .         .           g.26364
ctgcctcactgcgaggacttctcccctctcagagccactcaccacagttgccagacgtgc  c.1391-421

.         .         .         .         .         .           g.26424
agtgctttattttctgctggactggagcatttagcttgttaatgtttctttagaaagata  c.1391-361

.         .         .         .         .         .           g.26484
attgtttctagttaaacatgttgtttgaaaaatatacccagatgtatatttttatgtcgt  c.1391-301

.         .         .         .         .         .           g.26544
ggtgctataatttctacttttttccccttcaaaatatctaagttactggaaaatttcaac  c.1391-241

.         .         .         .         .         .           g.26604
ttaggaacaaatctgttggagaaagtgaggtatgtttaagtgtttatttcttaaggaaag  c.1391-181

.         .         .         .         .         .           g.26664
taaatgttctacataaaaaatgattattgagataatcactgttaactaatttaaaaacaa  c.1391-121

.         .         .         .         .         .           g.26724
aaaatgtcatttaagaggcccatatagcatcaatatcaagtaaacaattatgtcaccttt  c.1391-61

.         .         .         .         .         .           g.26784
tgctttaggaaaccaaatatcactgctaacccatatgtcgtctttttattttttcttcag  c.1391-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center