FK506 binding protein 14, 22 kDa (FKBP14) - coding DNA reference sequence

(used for mutation description)

(last modified July 20, 2012)


This file was created to facilitate the description of sequence variants on transcript NM_017946.2 in the FKBP14 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering FKBP14 transcript NM_017946.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5024
                                     taaatgtgccacgtcttctaagaa       c.-121

 .         .         .         .         .         .                g.5084
 gggggagtcctgaacttgtctgaagcccttgtccgtaagccttgaactacgttcttaaat       c.-61

 .         .         .         .         .         .                g.5144
 ctatgaagtcgagggacctttcgctgcttttgtagggacttctttccttgcttcagcaac       c.-1

          .         .         .         .         .         .       g.5204
 ATGAGGCTTTTCTTGTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCT       c.60
 M  R  L  F  L  W  N  A  V  L  T  L  F  V  T  S  L  I  G  A         p.20

          .         .         .         .         .         .       g.5264
 TTGATCCCTGAACCAGAAGTGAAAATTGAAGTTCTCCAGAAGCCATTCATCTGCCATCGC       c.120
 L  I  P  E  P  E  V  K  I  E  V  L  Q  K  P  F  I  C  H  R         p.40

          .         .         .         .         .         .       g.5324
 AAGACCAAAGGAGGGGATTTGATGTTGGTCCACTATGAAGGCTACTTAGAAAAGGACGGC       c.180
 K  T  K  G  G  D  L  M  L  V  H  Y  E  G  Y  L  E  K  D  G         p.60

          .        | 02.         .         .         .         .    g.8879
 TCCTTATTTCACTCCAC | TCACAAACATAACAATGGTCAGCCCATTTGGTTTACCCTGGGC    c.240
 S  L  F  H  S  T  |  H  K  H  N  N  G  Q  P  I  W  F  T  L  G      p.80

          .         .         .         .         .         .       g.8939
 ATCCTGGAGGCTCTCAAAGGTTGGGACCAGGGCTTGAAAGGAATGTGTGTAGGAGAGAAG       c.300
 I  L  E  A  L  K  G  W  D  Q  G  L  K  G  M  C  V  G  E  K         p.100

          .         .         .         .          | 03        .    g.12540
 AGAAAGCTCATCATTCCTCCTGCTCTGGGCTATGGAAAAGAAGGAAAAG | GTAAAATTCCC    c.360
 R  K  L  I  I  P  P  A  L  G  Y  G  K  E  G  K  G |   K  I  P      p.120

          .         .         .         .         .         .       g.12600
 CCAGAAAGTACACTGATATTTAATATTGATCTCCTGGAGATTCGAAATGGACCAAGATCC       c.420
 P  E  S  T  L  I  F  N  I  D  L  L  E  I  R  N  G  P  R  S         p.140

          .         .         .         .         .        | 04.    g.16762
 CATGAATCATTCCAAGAAATGGATCTTAATGATGACTGGAAACTCTCTAAAGATGAG | GTT    c.480
 H  E  S  F  Q  E  M  D  L  N  D  D  W  K  L  S  K  D  E   | V      p.160

          .         .         .         .         .         .       g.16822
 AAAGCATATTTAAAGAAGGAGTTTGAAAAACATGGTGCGGTGGTGAATGAAAGTCATCAT       c.540
 K  A  Y  L  K  K  E  F  E  K  H  G  A  V  V  N  E  S  H  H         p.180

          .         .         .         .         .         .       g.16882
 GATGCTTTGGTGGAGGATATTTTTGATAAAGAAGATGAAGACAAAGATGGGTTTATATCT       c.600
 D  A  L  V  E  D  I  F  D  K  E  D  E  D  K  D  G  F  I  S         p.200

          .         .         .                                     g.16918
 GCCAGAGAATTTACATATAAACACGATGAGTTATAG                               c.636
 A  R  E  F  T  Y  K  H  D  E  L  X                                 p.211

          .         .         .         .         .         .       g.16978
 agatacatctacccttttaatatagcactcatctttcaagagagggcagtcatctttaaa       c.*60

          .         .         .         .         .         .       g.17038
 gaacattttatttttatacaatgttctttcttgctttgttttttatttttatatattttt       c.*120

          .         .         .         .         .         .       g.17098
 tctgactcctatttaaagaaccccttaggtttctaagtacccatttctttctgataagtt       c.*180

          .         .         .         .         .         .       g.17158
 attgggaagaaaaagctaattggtctttgaatagaagacttctggacaatttttcacttt       c.*240

          .         .         .         .         .         .       g.17218
 cacagatatgaagctttgttttactttctcacttataaatttaaaatgttgcaactggga       c.*300

          .         .         .         .         .         .       g.17278
 atataccacgacatgagaccaggttatagcacaaattagcaccctatatttctgcttccc       c.*360

          .         .         .         .         .         .       g.17338
 tctattttctccaagttagaggtcaacatttgaaaagccttttgcaatagcccaaggctt       c.*420

          .         .         .         .         .         .       g.17398
 gctattttcatgttataatgaaatagtttatgtgtaactggctctgagtctctgcttgag       c.*480

          .         .         .         .         .         .       g.17458
 gaccagaggaaaatggttgttggacctgacttgttaatggctactgctttactaaggaga       c.*540

          .         .         .         .         .         .       g.17518
 tgtgcaatgctgaagttagaaacaaggttaatagccaggcatggtggctcatgcctgtaa       c.*600

          .         .         .         .         .         .       g.17578
 tcccagcactttgggaggctgaggcgggcggatcacctgaggttgggagttcgagaccag       c.*660

          .         .         .         .         .         .       g.17638
 cctgaccaacacggagaaaccctatctctactaaaaatacaaaagtagccgggcgtggtg       c.*720

          .         .         .         .         .         .       g.17698
 atgcgtgcctgtaatcccagctacccaggaaggctgaggcggcagaatcacttgaacccg       c.*780

          .         .         .         .         .         .       g.17758
 gaggcggaggttgcggtaagccgagatcacctccagcctggacactctgtctcgaaaaaa       c.*840

          .         .         .         .         .         .       g.17818
 agaaaagaaacacggttaataacatataaatatgtatgcattgagacatgctacctagga       c.*900

          .         .         .         .         .         .       g.17878
 cttaagctgatgaagcttggctcctagtgattggtggcctattatgataaataggacaaa       c.*960

          .         .         .         .         .         .       g.17938
 tcatttatgtgtgagtttctttgtaataaaatgtatcaatatgttatagatgaggtagaa       c.*1020

          .         .         .         .         .         .       g.17998
 agttatatttatattcaatatttacttcttaaggctagcggaatatccttcctggttctt       c.*1080

          .         .         .         .         .         .       g.18058
 taatgggtagtctatagtatattatactacaataacattgtatcataagataaagtagta       c.*1140

          .         .         .         .         .         .       g.18118
 aaccagtctacattttcccatttctgtctcatcaaaaactgaagttagctgggtgtggtg       c.*1200

          .         .         .         .         .         .       g.18178
 gctcatgcctgtaatcccagcactttgggggccaaggagggtggatcacttgagatcagg       c.*1260

          .         .         .         .         .         .       g.18238
 agttcaagaccagcctggccaacatggtgaaaccttgtctctactaaaaatacaaaaatt       c.*1320

          .         .         .         .         .         .       g.18298
 agccaggcgtggtggtgcacacctgtagtcccagctactcgggaggctgagacaggagat       c.*1380

          .         .         .         .         .         .       g.18358
 ttgcttgaacccgggaggcggaggttgcagtgagccaagattgtgccactgcactccagc       c.*1440

          .         .                                               g.18385
 ctgggtgacagagcaagactccatctc                                        c.*1467

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The FK506 binding protein 14, 22 kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build beta-06
©2004-2012 Leiden University Medical Center