fukutin (FKTN) - coding DNA reference sequence

(used for variant description)

(last modified December 30, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_001079802.1 in the FKTN gene based on a coding DNA reference sequence following the HGVS recommendation. The sequence was taken from NG_008754.1, covering FKTN transcript-1 (NM_001079802.1).  Transcript variant-2 (NM_006731.2) skips exon 02. Transcript variant-3 (NM_001198963.1) uses an alternatively spliced intron, derived from exon 11, encoding an alternative shorter C-terminus (protein isoform b).  Intron 2 contains an alternatively spliced exon02b.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                               .         .         .                g.5036
                         gtaaagcggagcggctgcagcctgctgttgagtgag       c.-181

  | 02        .         .         .         .         .             g.20585
  | attgaaaggaaacacactgaatgaggaaaaactaacatacggtcatcaacatccttgtat    c.-121

 .         .         .         .  | 03      .         .             g.21843
 aacctagtttttaaaaaaattggatttcaaag | aaaacaaaattatcttcctttccaaatc    c.-61

 .         .         .         .         .         .                g.21903
 caaaaagatgaaaacgactgagatactttcaaaagacaaccaagtgagcagcacagacta       c.-1

          .         .         .         .         .         .       g.21963
 ATGAGTAGAATCAATAAGAACGTGGTTTTGGCCCTTTTAACGCTGACAAGTTCTGCATTT       c.60
 M  S  R  I  N  K  N  V  V  L  A  L  L  T  L  T  S  S  A  F         p.20

          .         .         .         .      | 04  .         .    g.43483
 CTGCTGTTTCAGTTGTACTACTACAAGCACTATTTATCAACAAAG | AATGGAGCTGGTTTG    c.120
 L  L  F  Q  L  Y  Y  Y  K  H  Y  L  S  T  K   | N  G  A  G  L      p.40

          .         .         .         .      | 05  .         .    g.48030
 TCAAAATCCAAAGGAAGCCGAATTGGATTTGATAGCACACAGTGG | CGTGCAGTTAAAAAA    c.180
 S  K  S  K  G  S  R  I  G  F  D  S  T  Q  W   | R  A  V  K  K      p.60

          .         .         .         .         .         .       g.48090
 TTTATTATGTTAACATCCAACCAAAATGTACCAGTGTTTCTTATTGATCCTTTGATACTG       c.240
 F  I  M  L  T  S  N  Q  N  V  P  V  F  L  I  D  P  L  I  L         p.80

          .         .         .         .         .         .       g.48150
 GAATTGATTAATAAGAACTTTGAACAAGTCAAAAATACTTCTCATGGCTCTACTTCACAA       c.300
 E  L  I  N  K  N  F  E  Q  V  K  N  T  S  H  G  S  T  S  Q         p.100

          .         .         .         .         .         .       g.48210
 TGCAAGTTTTTCTGTGTTCCAAGAGACTTTACTGCATTTGCACTGCAGTATCACCTATGG       c.360
 C  K  F  F  C  V  P  R  D  F  T  A  F  A  L  Q  Y  H  L  W         p.120

           | 06        .         .         .         .         .    g.51136
 AAGAATGAG | GAAGGCTGGTTTCGGATAGCTGAGAATATGGGATTTCAGTGCCTAAAGATT    c.420
 K  N  E   | E  G  W  F  R  I  A  E  N  M  G  F  Q  C  L  K  I      p.140

          .         .         .         .         .         .       g.51196
 GAGAGTAAAGATCCCCGGCTAGACGGGATAGACTCACTCTCTGGAACTGAAATCCCCCTG       c.480
 E  S  K  D  P  R  L  D  G  I  D  S  L  S  G  T  E  I  P  L         p.160

          .         .         .         .         .         .       g.51256
 CACTATATCTGCAAACTGGCCACTCATGCGATCCACTTGGTAGTCTTTCATGAGAGGAGT       c.540
 H  Y  I  C  K  L  A  T  H  A  I  H  L  V  V  F  H  E  R  S         p.180

          .         .         .         .         .         .       g.51316
 GGCAACTACCTCTGGCACGGCCACTTGAGACTTAAAGAACACATTGACAGGAAATTTGTT       c.600
 G  N  Y  L  W  H  G  H  L  R  L  K  E  H  I  D  R  K  F  V         p.200

          .         .         .         .        | 07.         .    g.54702
 CCCTTCCGAAAGTTACAGTTTGGTCGTTATCCAGGAGCTTTTGACAG | GCCAGAGTTACAG    c.660
 P  F  R  K  L  Q  F  G  R  Y  P  G  A  F  D  R  |  P  E  L  Q      p.220

          .         .         .         .         .         .       g.54762
 CAAGTTACTGTTGATGGACTGGAAGTTCTCATTCCAAAGGATCCAATGCACTTTGTAGAA       c.720
 Q  V  T  V  D  G  L  E  V  L  I  P  K  D  P  M  H  F  V  E         p.240

          .         .         .         .         .         .       g.54822
 GAAGTACCACACTCTAGGTTTATTGAGTGTAGGTATAAAGAAGCTCGAGCATTCTTTCAG       c.780
 E  V  P  H  S  R  F  I  E  C  R  Y  K  E  A  R  A  F  F  Q         p.260

  | 08       .         .         .         .         .         .    g.62208
  | CAGTACCTTGATGATAACACTGTGGAAGCTGTGGCCTTTCGGAAGAGTGCAAAGGAATTA    c.840
  | Q  Y  L  D  D  N  T  V  E  A  V  A  F  R  K  S  A  K  E  L      p.280

          .         .         .         .         .         .       g.62268
 CTGCAACTAGCAGCGAAAACATTAAACAAATTGGGAGTACCATTCTGGCTGAGCAGTGGA       c.900
 L  Q  L  A  A  K  T  L  N  K  L  G  V  P  F  W  L  S  S  G         p.300

          . | 09       .         .         .         .         .    g.64879
 ACTTGTCTAG | GATGGTATCGACAATGCAACATTATTCCTTATAGCAAAGATGTTGACCTA    c.960
 T  C  L  G |   W  Y  R  Q  C  N  I  I  P  Y  S  K  D  V  D  L      p.320

          .         .         .         .         .         .       g.64939
 GGAATTTTTATACAAGATTACAAATCTGATATTATTTTAGCATTTCAGGATGCAGGACTT       c.1020
 G  I  F  I  Q  D  Y  K  S  D  I  I  L  A  F  Q  D  A  G  L         p.340

          .         .     | 10   .         .         .         .    g.66840
 CCGCTCAAACACAAATTTGGGAAG | GTAGAAGACAGCTTGGAACTATCCTTCCAGGGAAAA    c.1080
 P  L  K  H  K  F  G  K   | V  E  D  S  L  E  L  S  F  Q  G  K      p.360

          .         .         .         .         .         .       g.66900
 GATGATGTAAAACTTGATGTTTTTTTCTTCTATGAAGAAACTGATCACATGTGGAATGGA       c.1140
 D  D  V  K  L  D  V  F  F  F  Y  E  E  T  D  H  M  W  N  G         p.380

          .         .         .   | 11     .         .         .    g.81949
 GGCACTCAGGCCAAAACAGGAAAAAAATTCAA | ATACCTGTTTCCGAAGTTTACACTGTGC    c.1200
 G  T  Q  A  K  T  G  K  K  F  K  |  Y  L  F  P  K  F  T  L  C      p.400

          .         .         .         .         .         .       g.82009
 TGGACTGAGTTTGTAGACATGAAGGTCCATGTACCCTGTGAAACCCTCGAATACATTGAA       c.1260
 W  T  E  F  V  D  M  K  V  H  V  P  C  E  T  L  E  Y  I  E         p.420

          .         .         .         .         .         .       g.82069
 GCCAACTATGGTAAGACCTGGAAGATTCCTGTAAAGACGTGGGACTGGAAGCGCTCTCCT       c.1320
 A  N  Y  G  K  T  W  K  I  P  V  K  T  W  D  W  K  R  S  P         p.440

          .         .         .         .         .         .       g.82129
 CCCAATGTGCAACCCAATGGAATCTGGCCTATTTCTGAGTGGGATGAGGTTATCCAGTTA       c.1380
 P  N  V  Q  P  N  G  I  W  P  I  S  E  W  D  E  V  I  Q  L         p.460

                                                                    g.82135
 TATTGA                                                             c.1386
 Y  X                                                               p.461

          .         .         .         .         .         .       g.82195
 gatagtaggttgaaatgggagaatttctcttttggaaaaaaaggtagataactgtttaaa       c.*60

          .         .         .         .         .         .       g.82255
 aaatacatgtctatttgtcaaacataagtgggaaccaaagaaaaaatgtgacaagtttga       c.*120

          .         .         .         .         .         .       g.82315
 agacacagaaagagtcatctgatgtaattctctcacttagtactgaggaattttcatgtg       c.*180

          .         .         .         .         .         .       g.82375
 ccacatacaatgctaggttacagtggagaagcctagatgaatgagacaaatacctacttc       c.*240

          .         .         .         .         .         .       g.82435
 ttttattcctccttttggtaaacaactcaattttcctttgagggaaccctcccccaccct       c.*300

          .         .         .         .         .         .       g.82495
 ttgaagagttcaagttctgtacaggtttttaaaacgtgaagtaatgtttgaactggaaga       c.*360

          .         .         .         .         .         .       g.82555
 tgagctcaccaggcaaagctaaggaaggatatactagttgaaaagaataacccactcctc       c.*420

          .         .         .         .         .         .       g.82615
 ttctgggcatttaagctggtatgttagtgctacttttaagattgtggagtctgagttaat       c.*480

          .         .         .         .         .         .       g.82675
 attcaagtgatcagactttgagtgacatcaagaaaagatgatatcaggttcatttttcaa       c.*540

          .         .         .         .         .         .       g.82735
 ctaatcttatgtggaattgaattagagaacaaggcattattcttttagggaaggtgagag       c.*600

          .         .         .         .         .         .       g.82795
 cttatttgtatcagagcttattacttgtcaggataagtaaatttctgtacatgtactgtt       c.*660

          .         .         .         .         .         .       g.82855
 ttcatatgtgaagtgagaagaaactttatgcttgtttaatgcttaaatttccatccattg       c.*720

          .         .         .         .         .         .       g.82915
 tgagaatattttcactgacctctgatggcacttgttgacaaatcattcaagtgagaccat       c.*780

          .         .         .         .         .         .       g.82975
 gttactagacatgatcttgaaagaggccatgatttcacaaaactcatttttattttattc       c.*840

          .         .         .         .         .         .       g.83035
 tcagacagtctgttaggtaaaaatatgagaaattcatgtacattttatattttctgaatt       c.*900

          .         .         .         .         .         .       g.83095
 tataatctgtgcactcccaattttaatgacactaaaatattaatagaattttttaaatat       c.*960

          .         .         .         .         .         .       g.83155
 actctaatttttaaaacatactctttattatcttcatttatcaattacagcttcgtatct       c.*1020

          .         .         .         .         .         .       g.83215
 ctaatttatggtctatataccaatttaaatggcatgtaaacctgcctgtttcttctcctc       c.*1080

          .         .         .         .         .         .       g.83275
 ttctaatatatcagatctccaaaatggaagctaaatggtggacttgacaactattcaccc       c.*1140

          .         .         .         .         .         .       g.83335
 tacctcagatcatagagtttgtaaagtttgtgtccctccccagtttttcagtctgttgaa       c.*1200

          .         .         .         .         .         .       g.83395
 tgtcgatggggcaagaactcagacttctactttaccaagtaccacacactctggaatgct       c.*1260

          .         .         .         .         .         .       g.83455
 ttagtttccttttcccctcaagatgtctgagtcagctaggatgctgtttaccccatctct       c.*1320

          .         .         .         .         .         .       g.83515
 ctcttatatcacttgaatgatatattgtaagtgagaggtaaaggaaaatgtaggcacaat       c.*1380

          .         .         .         .         .         .       g.83575
 aagcactgctatttttctctttgtctaggaaaggaagctgaatcttatatcttatctatg       c.*1440

          .         .         .         .         .         .       g.83635
 ctatttaggactactttctggagcttggcagattttcctctgacaccagagaacaatagt       c.*1500

          .         .         .         .         .         .       g.83695
 agtctcaagaatggaaacctgaatgtctgagggaatgggctggtagactttttcgaaaac       c.*1560

          .         .         .         .         .         .       g.83755
 aaattagagaaagtaacttacaaccacccattccggatttgtaaagcaacatgaaaacct       c.*1620

          .         .         .         .         .         .       g.83815
 ttgataaatgataaccaacagtcttctgtcctaatttgcattctcaatgcagaattattg       c.*1680

          .         .         .         .         .         .       g.83875
 ggtctttcataaataacatgagtggtttctggagacatttaagattgtcagcaaacttgt       c.*1740

          .         .         .         .         .         .       g.83935
 cccaaaatggcacatcatcataatccattttctctttgctagaaaatcagcccatagagt       c.*1800

          .         .         .         .         .         .       g.83995
 gcattcccaaattctaaatagctgaccctaaattcatttttcatgcttaaaaataataga       c.*1860

          .         .         .         .         .         .       g.84055
 acaaataataatactatttttgggcaaaatccaccctacttgatgaggaccatttgcttg       c.*1920

          .         .         .         .         .         .       g.84115
 tgctcagtatttagaaatgcatacactccacatttctccccatttccaattgggactccc       c.*1980

          .         .         .         .         .         .       g.84175
 attctttgccaggagatcttacccatcccttttcagattaatcttttatcctttcctgaa       c.*2040

          .         .         .         .         .         .       g.84235
 gtacaaagtcttaagagtgtctgaaatccaagacatcttggcccaattgacacaggttct       c.*2100

          .         .         .         .         .         .       g.84295
 atattcttccctacatagaccactggctgctgaaatacttttcttgtcttctggtttcac       c.*2160

          .         .         .         .         .         .       g.84355
 aggcttcagctcatgggttccaccctaacttggggaaacaaaagccttctctagaatctg       c.*2220

          .         .         .         .         .         .       g.84415
 aaggccaggcttacctctgattctgattcatccatacttcatcttatgtattttaacagt       c.*2280

          .         .         .         .         .         .       g.84475
 tgggttctgtggagtgtccagagaccttgggttaggtatatccatcttcagtacctcatt       c.*2340

          .         .         .         .         .         .       g.84535
 ggatcacttttctttcatcacttgagtattctagcagtcattctcctaatctgaccactt       c.*2400

          .         .         .         .         .         .       g.84595
 tcaggtttagtttacctggcttacctggggaagttgacaacttgttggtagttaggcacc       c.*2460

          .         .         .         .         .         .       g.84655
 catgaatgtctccagagacatcctgagaggcaagattcctcttaattgataaccaggaca       c.*2520

          .         .         .         .         .         .       g.84715
 accaggtagtcacccagtcctctctaagcagggagcacttgtccttctctcctctgctgc       c.*2580

          .         .         .         .         .         .       g.84775
 agctactgatatctggcccctggaataaaaccatagttcctaaaattgagcatccctaag       c.*2640

          .         .         .         .         .         .       g.84835
 agtagctgcttggtgggacagctgatttctttgattccctagctgcaaaacctgaaattg       c.*2700

          .         .         .         .         .         .       g.84895
 accactaggtgacagaatgtttgccagtatccccacaaaacaagttaaaacttaagtgaa       c.*2760

          .         .         .         .         .         .       g.84955
 aatcattctgcttttgaatcttaaaagctagaaaaaccataatgtaatattctttttaaa       c.*2820

          .         .         .         .         .         .       g.85015
 ccctcttattttataactaaataaataatcacagaaaagaatgatctgaacaagaacagc       c.*2880

          .         .         .         .         .         .       g.85075
 tgaggctaaaacccaagactgccgtgactcctagtccaatgtctgtttcgcatcacaaca       c.*2940

          .         .         .         .         .         .       g.85135
 cagtatctttaacagtgcttgagatgcttaacagagaaggcatccagtgcttcattgagg       c.*3000

          .         .         .         .         .         .       g.85195
 ctaagtctcagggtgtttctgccgcttagtatctttttgttcagattgagaacctaaggc       c.*3060

          .         .         .         .         .         .       g.85255
 gacagagaggtcaaggggaagtattttctagttcagaattcagaattcttaggcaacctt       c.*3120

          .         .         .         .         .         .       g.85315
 catacctttatctggaaaatgccttctctccagacaataagacagttcacatctggagac       c.*3180

          .         .         .         .         .         .       g.85375
 atcagcctttggtacctaattctctaagctcaagatgcatcccattgccactttaccatt       c.*3240

          .         .         .         .         .         .       g.85435
 ctatttcccaagggaaccatcagcaccaacctgctaaatgcctgtatttgaagtctctcc       c.*3300

          .         .         .         .         .         .       g.85495
 ccttcctgaagtgaccttttatgaggctctttccttcctaagggacctttccctggtagt       c.*3360

          .         .         .         .         .         .       g.85555
 agtggtctcattcacaaaaaagaataatagatgtaactggagtcactttgcagttttcaa       c.*3420

          .         .         .         .         .         .       g.85615
 gattttttttttatctgcttggctggaaaggagactagagtatctagtttttagtattta       c.*3480

          .         .         .         .         .         .       g.85675
 aactacttttaattatttatattgatactctctgataaatgcaggtagttaagaatagat       c.*3540

          .         .         .         .         .         .       g.85735
 tgtactcattcctttttgagtttgtgacctcaaaccattgtttttattcttacacgacta       c.*3600

          .         .         .         .         .         .       g.85795
 cagtacttcaaatggcacatagataggcaggatattacataggtaagcaggaatttatac       c.*3660

          .         .         .         .         .         .       g.85855
 attgggtaccagagctaaatctggaaaacacatttggaatgagcttccacacttcagtct       c.*3720

          .         .         .         .         .         .       g.85915
 aaaatctcacccaaacttatggctacatatttttctaagtttcccccctagtttcacttt       c.*3780

          .         .         .         .         .         .       g.85975
 ctggaaagtgaacagttttttaaatcctaaatgttataaatccttaggagaaatattccc       c.*3840

          .         .         .         .         .         .       g.86035
 tcaaaacctagtcaagaaagtgccacattcccaccttctaacaggtaattattagttgta       c.*3900

          .         .         .         .         .         .       g.86095
 atagctttaatgcatggaaaaacttcagttactgaccagtcaagagaatttctcaagaaa       c.*3960

          .         .         .         .         .         .       g.86155
 aatcccagcaacgttccctctttcctccttgtcttccactatcattaagacctgggctag       c.*4020

          .         .         .         .         .         .       g.86215
 atcacctctaacatctcactcagggaaggcaatgtgttgccataaaaagaccacaagctt       c.*4080

          .         .         .         .         .         .       g.86275
 ttgagttaggcctgaatttgaatttcagcttaatcatgtgggatttatggtgggggccct       c.*4140

          .         .         .         .         .         .       g.86335
 ttcagtctcaatttccacattagtgaactggggaaatgatacatacttctaagggttttt       c.*4200

          .         .         .         .         .         .       g.86395
 agggggattaaatgaagtatacagttcttagcctcaggcctaggattaagtaagtactca       c.*4260

          .         .         .         .         .         .       g.86455
 agaaatgtgcaattttctagttccatgtttcttttctaatcttcaaatggaattatagaa       c.*4320

          .         .         .         .         .         .       g.86515
 accatgggtcagaacatattcctttactcaaaagattgcatgactgaatttgcttaagaa       c.*4380

          .         .         .         .         .         .       g.86575
 aaaaaaaattgtatcaagtcattaatacaattatacattaattatattacattaatacaa       c.*4440

          .         .         .         .         .         .       g.86635
 tatatggtttgtgaattcagagacattaccagtttgcctccttctctcaatagaacttgt       c.*4500

          .         .         .         .         .         .       g.86695
 attttcattttcttggttaagcagttgtctcctaatattatcccatatgctacctagttt       c.*4560

          .         .         .         .         .         .       g.86755
 gctggtcccaagcagtttactgtacttcactagatttggtacctgctctcccctggactt       c.*4620

          .         .         .         .         .         .       g.86815
 ctttttcaatattctagcctttcctagatgtaaatctttacctccttgttagtgaaatta       c.*4680

          .         .         .         .         .         .       g.86875
 gatataagccatgatttggagagggaagaaatctggaatacttaatttcatttaattatc       c.*4740

          .         .         .         .         .         .       g.86935
 tatgctgatgaatgcctgtatcattgttaataaaggagaattgaaaatactcatttctac       c.*4800

          .         .         .         .         .         .       g.86995
 tttctgccctcaaatttctgtttctatctcaactaggcaagaatcagcagggtgcatgat       c.*4860

          .         .         .         .         .         .       g.87055
 gccattttaagctgcttcacatcagactgaaatcctaattacagttcataagtgaaacag       c.*4920

          .         .         .         .         .         .       g.87115
 actaattcaatggcaataccttttgtataggtcctgtgcttaaaggaggcaagtataaat       c.*4980

          .         .         .         .         .         .       g.87175
 tttctaataagaaatccctgcttcttttgggtgcagtggctcacacctgtaataccagca       c.*5040

          .         .         .         .         .         .       g.87235
 gtttgagaagctaaggcaggtggatcacttgaggccaggagttcgagaccagcctggcca       c.*5100

          .         .         .         .         .         .       g.87295
 acatagtgaaaccccgtctcttctaaaaatacaaaaaaattagctgggcatggtggtgca       c.*5160

          .         .         .         .         .         .       g.87355
 cgcctatagtcccagctacacaggaggctgaggcaggagaatcacttgaacccgggaagc       c.*5220

          .         .         .         .         .         .       g.87415
 agagtctgcagtgagccaagatcgcggcattgcacttcagcctgggcgatagagcaagac       c.*5280

          .         .         .         .         .         .       g.87475
 tctgtctcagaaaaaaaaaaaaaggaaagaaagaaatctctgcttccgtactatcaaaac       c.*5340

          .         .         .         .         .         .       g.87535
 ttctaccctagaataccccctggcaccttctaacccaacctaatacagagattttgtagg       c.*5400

          .         .         .         .         .         .       g.87595
 gacccattaacaagctcctatataattataagcagctctcacagtagggttgaaagagaa       c.*5460

          .         .         .         .         .         .       g.87655
 tataaggaaaattagaagtactgtatttttgctattggaaatgaaatattgtttcatgca       c.*5520

          .         .         .         .         .         .       g.87715
 cctttgaaaaaaataacaggattttacagccttctgatgattcattcaaagcatggggaa       c.*5580

          .         .         .         .         .         .       g.87775
 tagttcatatgtttgttaaatgaaaatcttatgtagctatttgtgtgtccctcccacttc       c.*5640

          .         .         .         .         .         .       g.87835
 ataactacaaaaacatatatatgaatttctaaacaaagtgatattttaaagatgaattga       c.*5700

          .         .         .         .         .         .       g.87895
 ttcaatgtgtacttaccagtttactgtgtggttttatcttcaggtacagatagtttgtgg       c.*5760

          .         .         .         .         .         .       g.87955
 tactacttgaaaatacctttaatattattttcatcagaatttgtaatatataatccagtt       c.*5820

          .         .         .                                     g.87989
 tgggatgatgaataaaatttttctaatctcttga                                 c.*5854

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Fukutin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center