filamin C, gamma (FLNC) - coding DNA reference sequence

(used for variant description)

(last modified October 31, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_001458.4 in the FLNC gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011807.1, covering FLNC transcript NM_001458.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5029
                                ccctggagggagagagagccagagagcgg       c.-181

 .         .         .         .         .         .                g.5089
 ccgagcgcctaggaggcccgccgagcctcgccgagccccgccagccccggcgcgagagaa       c.-121

 .         .         .         .         .         .                g.5149
 gttggagaggagagcagcgcagcgcagcgagtcccgtggtcgcgccccaacagcgcccga       c.-61

 .         .         .         .         .         .                g.5209
 cagcccccgatagcccaaaccgcggccctagccccggccgcacccccagcccgcgccagc       c.-1

          .         .         .         .         .         .       g.5269
 ATGATGAACAACAGCGGCTACTCAGACGCCGGCCTCGGCCTGGGCGATGAGACAGACGAG       c.60
 M  M  N  N  S  G  Y  S  D  A  G  L  G  L  G  D  E  T  D  E         p.20

          .         .         .         .         .         .       g.5329
 ATGCCGTCCACGGAGAAGGACCTGGCGGAGGACGCGCCGTGGAAGAAGATCCAGCAGAAC       c.120
 M  P  S  T  E  K  D  L  A  E  D  A  P  W  K  K  I  Q  Q  N         p.40

          .         .         .         .         .         .       g.5389
 ACATTCACGCGCTGGTGCAATGAGCACCTCAAGTGCGTGGGCAAGCGCCTGACCGACCTG       c.180
 T  F  T  R  W  C  N  E  H  L  K  C  V  G  K  R  L  T  D  L         p.60

          .         .         .         .         .         .       g.5449
 CAGCGCGACCTCAGCGACGGGCTCCGGCTCATCGCGCTGCTCGAGGTGCTCAGCCAGAAG       c.240
 Q  R  D  L  S  D  G  L  R  L  I  A  L  L  E  V  L  S  Q  K         p.80

          .         .         .         .         .         .       g.5509
 CGCATGTACCGCAAGTTCCATCCGCGCCCCAACTTCCGCCAAATGAAGCTGGAGAACGTG       c.300
 R  M  Y  R  K  F  H  P  R  P  N  F  R  Q  M  K  L  E  N  V         p.100

          .         .         .         .         .   | 02     .    g.9905
 TCCGTGGCCCTCGAGTTCCTCGAGCGCGAGCACATCAAGCTCGTGTCCATAG | ACAGCAAG    c.360
 S  V  A  L  E  F  L  E  R  E  H  I  K  L  V  S  I  D |   S  K      p.120

          .         .         .         .         .         .       g.9965
 GCCATCGTGGATGGGAACCTGAAGCTGATCCTGGGCCTGATCTGGACGCTGATCCTGCAC       c.420
 A  I  V  D  G  N  L  K  L  I  L  G  L  I  W  T  L  I  L  H         p.140

          .         .         .         .         .         .       g.10025
 TACTCCATCTCCATGCCCATGTGGGAGGATGAAGATGATGAGGATGCCCGCAAACAGACG       c.480
 Y  S  I  S  M  P  M  W  E  D  E  D  D  E  D  A  R  K  Q  T         p.160

          .         .         .         .         .         .       g.10085
 CCCAAGCAGCGGCTGCTTGGCTGGATCCAGAACAAGGTGCCCCAGCTGCCCATCACCAAC       c.540
 P  K  Q  R  L  L  G  W  I  Q  N  K  V  P  Q  L  P  I  T  N         p.180

          .         .         .         .         .         .       g.10145
 TTCAACCGTGACTGGCAGGACGGCAAAGCTCTGGGCGCCCTGGTGGACAACTGCGCCCCC       c.600
 F  N  R  D  W  Q  D  G  K  A  L  G  A  L  V  D  N  C  A  P         p.200

   | 03      .         .         .         .         .         .    g.11790
 G | GTCTCTGCCCCGACTGGGAGGCCTGGGACCCCAACCAGCCCGTGGAGAACGCCCGGGAG    c.660
 G |   L  C  P  D  W  E  A  W  D  P  N  Q  P  V  E  N  A  R  E      p.220

          .         .         .          | 04        .         .    g.11990
 GCCATGCAGCAGGCCGACGACTGGCTTGGGGTGCCCCAG | GTCATTGCCCCTGAGGAGATT    c.720
 A  M  Q  Q  A  D  D  W  L  G  V  P  Q   | V  I  A  P  E  E  I      p.240

          .         .         .         .         .         .       g.12050
 GTGGACCCCAACGTGGATGAGCATTCTGTTATGACCTACCTGTCCCAGTTCCCCAAGGCC       c.780
 V  D  P  N  V  D  E  H  S  V  M  T  Y  L  S  Q  F  P  K  A         p.260

          .         .         .         .         .         .       g.12110
 AAGCTCAAACCTGGTGCCCCTGTTCGATCCAAGCAGCTGAACCCCAAGAAAGCCATCGCC       c.840
 K  L  K  P  G  A  P  V  R  S  K  Q  L  N  P  K  K  A  I  A         p.280

          . | 05       .         .         .         .         .    g.12258
 TATGGGCCTG | GCATCGAGCCACAGGGCAACACCGTGCTGCAGCCTGCCCACTTCACCGTG    c.900
 Y  G  P  G |   I  E  P  Q  G  N  T  V  L  Q  P  A  H  F  T  V      p.300

          .         .         .         .         .         .       g.12318
 CAGACGGTGGACGCGGGCGTGGGCGAGGTGCTGGTCTACATCGAGGACCCTGAAGGCCAC       c.960
 Q  T  V  D  A  G  V  G  E  V  L  V  Y  I  E  D  P  E  G  H         p.320

           | 06        .         .         .         .         .    g.12609
 ACCGAGGAG | GCTAAGGTGGTTCCCAACAATGACAAGGATCGCACCTATGCTGTCTCCTAT    c.1020
 T  E  E   | A  K  V  V  P  N  N  D  K  D  R  T  Y  A  V  S  Y      p.340

          .         .        | 07.         .         .         .    g.12871
 GTGCCCAAGGTCGCTGGGTTACACAAG | GTGACCGTGCTCTTTGCTGGCCAGAACATTGAA    c.1080
 V  P  K  V  A  G  L  H  K   | V  T  V  L  F  A  G  Q  N  I  E      p.360

          .         .         .         .         .         .       g.12931
 CGCAGTCCCTTTGAGGTGAACGTGGGCATGGCCCTGGGAGATGCCAACAAGGTGTCAGCC       c.1140
 R  S  P  F  E  V  N  V  G  M  A  L  G  D  A  N  K  V  S  A         p.380

          .         .         .         .         .         .       g.12991
 CGTGGCCCTGGCCTGGAACCTGTGGGCAATGTGGCCAACAAACCCACCTACTTTGACATC       c.1200
 R  G  P  G  L  E  P  V  G  N  V  A  N  K  P  T  Y  F  D  I         p.400

          . | 08       .         .         .         .         .    g.13224
 TACACTGCGG | GGGCCGGCACTGGCGATGTTGCTGTGGTGATCGTGGACCCACAGGGCCGG    c.1260
 Y  T  A  G |   A  G  T  G  D  V  A  V  V  I  V  D  P  Q  G  R      p.420

          .         .         .         .         .         .       g.13284
 CGGGACACAGTGGAGGTGGCCCTGGAGGACAAGGGTGACAGCACGTTCCGCTGCACATAC       c.1320
 R  D  T  V  E  V  A  L  E  D  K  G  D  S  T  F  R  C  T  Y         p.440

          .         .         .         .         .         .       g.13344
 AGACCTGCCATGGAGGGGCCACATACCGTGCATGTGGCCTTTGCGGGTGCCCCCATCACC       c.1380
 R  P  A  M  E  G  P  H  T  V  H  V  A  F  A  G  A  P  I  T         p.460

          .         .         .  | 09      .         .         .    g.14623
 CGCAGTCCCTTCCCTGTCCATGTGTCGGAAG | CCTGTAACCCCAACGCCTGCCGCGCCTCT    c.1440
 R  S  P  F  P  V  H  V  S  E  A |   C  N  P  N  A  C  R  A  S      p.480

          .         .         .         .         .         .       g.14683
 GGGCGAGGCCTGCAGCCCAAGGGTGTTCGCGTGAAAGAGGTGGCTGACTTCAAGGTGTTT       c.1500
 G  R  G  L  Q  P  K  G  V  R  V  K  E  V  A  D  F  K  V  F         p.500

          .         .         .         .          | 10        .    g.15130
 ACCAAGGGTGCCGGCAGCGGGGAGCTCAAGGTCACGGTCAAGGGGCCAA | AGGGCACAGAG    c.1560
 T  K  G  A  G  S  G  E  L  K  V  T  V  K  G  P  K |   G  T  E      p.520

          .         .         .         .         .         .       g.15190
 GAGCCAGTGAAGGTGCGGGAGGCTGGGGATGGTGTGTTCGAGTGCGAGTACTACCCGGTG       c.1620
 E  P  V  K  V  R  E  A  G  D  G  V  F  E  C  E  Y  Y  P  V         p.540

          .         .         .         .         .       | 11 .    g.15409
 GTGCCTGGGAAGTATGTGGTGACCATCACGTGGGGCGGCTACGCCATCCCTCGCAG | CCCC    c.1680
 V  P  G  K  Y  V  V  T  I  T  W  G  G  Y  A  I  P  R  S  |  P      p.560

          .         .         .         .         .         .       g.15469
 TTTGAGGTACAGGTGAGCCCAGAGGCAGGAGTGCAAAAGGTCCGGGCCTGGGGTCCTGGT       c.1740
 F  E  V  Q  V  S  P  E  A  G  V  Q  K  V  R  A  W  G  P  G         p.580

          .         .         .         .         .         .       g.15529
 TTGGAGACTGGCCAGGTGGGCAAGTCAGCCGATTTTGTGGTGGAAGCCATTGGCACCGAG       c.1800
 L  E  T  G  Q  V  G  K  S  A  D  F  V  V  E  A  I  G  T  E         p.600

          .    | 12    .         .         .         .         .    g.15788
 GTGGGGACACTGG | GCTTCTCCATCGAGGGGCCCTCACAAGCCAAGATCGAATGTGACGAC    c.1860
 V  G  T  L  G |   F  S  I  E  G  P  S  Q  A  K  I  E  C  D  D      p.620

          .         .         .         .         .         .       g.15848
 AAGGGGGATGGCTCCTGCGATGTGCGGTACTGGCCCACGGAGCCTGGGGAGTACGCTGTG       c.1920
 K  G  D  G  S  C  D  V  R  Y  W  P  T  E  P  G  E  Y  A  V         p.640

          .         .         .         .         .         .       g.15908
 CACGTCATCTGTGACGATGAGGACATCCGAGACTCACCCTTCATTGCCCACATCCTGCCC       c.1980
 H  V  I  C  D  D  E  D  I  R  D  S  P  F  I  A  H  I  L  P         p.660

          .         .        | 13.         .         .         .    g.16058
 GCCCCACCTGACTGCTTCCCAGATAAG | GTGAAGGCCTTTGGGCCTGGCCTGGAGCCTACC    c.2040
 A  P  P  D  C  F  P  D  K   | V  K  A  F  G  P  G  L  E  P  T      p.680

          .         .         .         .         .         .       g.16118
 GGCTGCATCGTGGACAAGCCCGCTGAGTTCACCATTGATGCTCGTGCAGCTGGCAAGGGA       c.2100
 G  C  I  V  D  K  P  A  E  F  T  I  D  A  R  A  A  G  K  G         p.700

          .         .  | 14      .         .         .         .    g.16841
 GACCTGAAGCTCTATGCCCAG | GACGCCGACGGCTGTCCCATCGACATCAAGGTGATCCCC    c.2160
 D  L  K  L  Y  A  Q   | D  A  D  G  C  P  I  D  I  K  V  I  P      p.720

          .         .         .         .         .         .       g.16901
 AACGGCGACGGCACCTTCCGCTGCTCCTACGTGCCCACCAAGCCCATTAAGCACACCATC       c.2220
 N  G  D  G  T  F  R  C  S  Y  V  P  T  K  P  I  K  H  T  I         p.740

          .         .         .         .      | 15  .         .    g.17161
 ATCATCTCCTGGGGAGGCGTAAACGTGCCCAAGAGCCCCTTCCGG | GTGAACGTGGGCGAG    c.2280
 I  I  S  W  G  G  V  N  V  P  K  S  P  F  R   | V  N  V  G  E      p.760

          .         .         .         .         .         .       g.17221
 GGCAGCCACCCCGAGCGGGTAAAGGTGTACGGCCCCGGAGTGGAGAAGACAGGCCTCAAG       c.2340
 G  S  H  P  E  R  V  K  V  Y  G  P  G  V  E  K  T  G  L  K         p.780

          .         .         .         .          | 16        .    g.17376
 GCCAATGAGCCCACCTACTTCACGGTGGACTGCAGCGAGGCGGGGCAAG | GCGACGTGAGC    c.2400
 A  N  E  P  T  Y  F  T  V  D  C  S  E  A  G  Q  G |   D  V  S      p.800

          .         .         .         .         .         .       g.17436
 ATCGGCATCAAGTGCGCCCCAGGCGTGGTGGGCCCTGCAGAGGCTGACATTGACTTCGAC       c.2460
 I  G  I  K  C  A  P  G  V  V  G  P  A  E  A  D  I  D  F  D         p.820

          .         .         .         .         .         .       g.17496
 ATCATCAAGAATGACAACGACACCTTCACCGTCAAGTACACGCCACCAGGGGCGGGCCGC       c.2520
 I  I  K  N  D  N  D  T  F  T  V  K  Y  T  P  P  G  A  G  R         p.840

          .         .         . | 17       .         .         .    g.17830
 TACACCATCATGGTGCTGTTTGCCAACCAG | GAGATCCCCGCCAGCCCCTTCCACATCAAG    c.2580
 Y  T  I  M  V  L  F  A  N  Q   | E  I  P  A  S  P  F  H  I  K      p.860

          .         .         .         .         .         .       g.17890
 GTGGACCCATCCCACGATGCCAGCAAAGTCAAGGCCGAGGGCCCTGGGCTGAATCGCACA       c.2640
 V  D  P  S  H  D  A  S  K  V  K  A  E  G  P  G  L  N  R  T         p.880

   | 18      .         .         .         .         .         .    g.18038
 G | GTGTGGAAGTCGGGAAGCCCACCCACTTCACGGTGCTGACCAAGGGAGCCGGCAAGGCC    c.2700
 G |   V  E  V  G  K  P  T  H  F  T  V  L  T  K  G  A  G  K  A      p.900

          .         .         .         .         .         .       g.18098
 AAGCTGGATGTGCAGTTTGCAGGGACAGCCAAGGGCGAGGTTGTGCGGGACTTTGAGATC       c.2760
 K  L  D  V  Q  F  A  G  T  A  K  G  E  V  V  R  D  F  E  I         p.920

          .         .         .         .         .  | 19      .    g.18376
 ATAGACAACCATGACTACTCCTACACTGTCAAGTACACCGCTGTCCAGCAG | GGCAACATG    c.2820
 I  D  N  H  D  Y  S  Y  T  V  K  Y  T  A  V  Q  Q   | G  N  M      p.940

          .         .         .         .         .         .       g.18436
 GCAGTGACAGTGACTTATGGCGGGGACCCTGTCCCCAAGAGCCCCTTTGTGGTGAATGTG       c.2880
 A  V  T  V  T  Y  G  G  D  P  V  P  K  S  P  F  V  V  N  V         p.960

          .         .         .         .          | 20        .    g.18586
 GCACCCCCGCTGGACCTCAGCAAAATCAAAGTTCAGGGCCTTAATAGCA | AGGTGGCTGTG    c.2940
 A  P  P  L  D  L  S  K  I  K  V  Q  G  L  N  S  K |   V  A  V      p.980

          .         .         .         .         .         .       g.18646
 GGACAGGAACAAGCATTCTCTGTGAACACACGAGGGGCTGGCGGTCAGGGCCAACTGGAT       c.3000
 G  Q  E  Q  A  F  S  V  N  T  R  G  A  G  G  Q  G  Q  L  D         p.1000

          .         .         .         .         .         .       g.18706
 GTGCGGATGACTTCGCCCTCTCGCCGGCCCATCCCCTGCAAGCTGGAGCCAGGCGGTGGA       c.3060
 V  R  M  T  S  P  S  R  R  P  I  P  C  K  L  E  P  G  G  G         p.1020

          .         .         .         .         .         .       g.18766
 GCGGAAGCCCAGGCTGTGCGCTACATGCCCCCGGAGGAGGGGCCCTACAAGGTGGATATC       c.3120
 A  E  A  Q  A  V  R  Y  M  P  P  E  E  G  P  Y  K  V  D  I         p.1040

          .         .         .         .         .         .       g.18826
 ACCTACGATGGTCACCCGGTGCCTGGCAGCCCGTTTGCTGTGGAGGGTGTCCTGCCCCCT       c.3180
 T  Y  D  G  H  P  V  P  G  S  P  F  A  V  E  G  V  L  P  P         p.1060

          .   | 21     .         .         .         .         .    g.19277
 GATCCCTCCAAG | GTCTGTGCTTATGGCCCGGGTCTCAAGGGTGGACTGGTAGGCACCCCC    c.3240
 D  P  S  K   | V  C  A  Y  G  P  G  L  K  G  G  L  V  G  T  P      p.1080

          .         .         .         .         .         .       g.19337
 GCGCCATTCTCCATCGACACCAAGGGGGCTGGCACAGGTGGCCTGGGGCTGACCGTAGAG       c.3300
 A  P  F  S  I  D  T  K  G  A  G  T  G  G  L  G  L  T  V  E         p.1100

          .         .         .         .         .         .       g.19397
 GGCCCCTGCGAGGCCAAGATCGAGTGCCAGGACAATGGTGATGGCTCATGTGCTGTCAGC       c.3360
 G  P  C  E  A  K  I  E  C  Q  D  N  G  D  G  S  C  A  V  S         p.1120

          .         .         .         .         .         .       g.19457
 TACCTGCCCACGGAGCCTGGCGAGTACACCATCAACATCCTGTTTGCTGAGGCCCACATC       c.3420
 Y  L  P  T  E  P  G  E  Y  T  I  N  I  L  F  A  E  A  H  I         p.1140

          .         .         .         .         .         .       g.19517
 CCTGGCTCGCCCTTCAAAGCCACCATTCGGCCTGTGTTTGACCCGAGCAAGGTGCGGGCC       c.3480
 P  G  S  P  F  K  A  T  I  R  P  V  F  D  P  S  K  V  R  A         p.1160

          .         .         .         .         .         .       g.19577
 AGTGGACCGGGCCTGGAGCGCGGCAAGGTCGGTGAGGCAGCCACCTTCACTGTGGACTGC       c.3540
 S  G  P  G  L  E  R  G  K  V  G  E  A  A  T  F  T  V  D  C         p.1180

          .         .         .         .         .         .       g.19637
 TCAGAGGCAGGCGAGGCGGAGCTGACCATTGAGATCCTGTCGGATGCCGGGGTCAAGGCC       c.3600
 S  E  A  G  E  A  E  L  T  I  E  I  L  S  D  A  G  V  K  A         p.1200

          .         .         .         .         .         .       g.19697
 GAGGTGCTGATCCACAACAACGCGGATGGCACCTACCACATCACCTACAGCCCTGCCTTC       c.3660
 E  V  L  I  H  N  N  A  D  G  T  Y  H  I  T  Y  S  P  A  F         p.1220

          .         .         .         .         .         .       g.19757
 CCTGGCACCTACACCATTACCATCAAGTATGGCGGGCATCCCGTGCCCAAATTCCCCACC       c.3720
 P  G  T  Y  T  I  T  I  K  Y  G  G  H  P  V  P  K  F  P  T         p.1240

          .         .         .         .         .         .       g.19817
 CGTGTCCATGTGCAGCCTGCGGTCGATACCAGTGGCGTCAAGGTCTCAGGGCCTGGTGTT       c.3780
 R  V  H  V  Q  P  A  V  D  T  S  G  V  K  V  S  G  P  G  V         p.1260

          . | 22       .         .         .         .         .    g.20611
 GAGCCACACG | GTGTCCTGCGGGAGGTGACCACTGAGTTCACTGTGGATGCAAGATCCCTA    c.3840
 E  P  H  G |   V  L  R  E  V  T  T  E  F  T  V  D  A  R  S  L      p.1280

          .         .         .         .         .         .       g.20671
 ACAGCCACAGGCGGCAACCACGTGACGGCTCGTGTGCTCAACCCCTCGGGGGCCAAGACA       c.3900
 T  A  T  G  G  N  H  V  T  A  R  V  L  N  P  S  G  A  K  T         p.1300

          .         .         .         .         .         .       g.20731
 GACACCTATGTGACAGACAATGGGGACGGCACCTACCGAGTGCAGTACACCGCCTACGAG       c.3960
 D  T  Y  V  T  D  N  G  D  G  T  Y  R  V  Q  Y  T  A  Y  E         p.1320

      | 23   .         .         .         .         .         .    g.20928
 GAGG | GCGTGCATCTGGTGGAGGTCCTGTATGATGAGGTCGCTGTGCCCAAGAGCCCCTTC    c.4020
 E  G |   V  H  L  V  E  V  L  Y  D  E  V  A  V  P  K  S  P  F      p.1340

          .         .         .         .         .         .       g.20988
 CGAGTGGGCGTGACCGAGGGCTGTGATCCCACCCGCGTCCGAGCCTTCGGGCCAGGCCTG       c.4080
 R  V  G  V  T  E  G  C  D  P  T  R  V  R  A  F  G  P  G  L         p.1360

          .         .         .         .        | 24.         .    g.21329
 GAGGGTGGCTTGGTCAACAAGGCCAACCGATTCACTGTGGAGACCAG | GGGAGCGGGCACC    c.4140
 E  G  G  L  V  N  K  A  N  R  F  T  V  E  T  R  |  G  A  G  T      p.1380

          .         .         .         .         .         .       g.21389
 GGGGGCCTTGGCCTAGCCATCGAGGGTCCCTCGGAAGCCAAGATGTCCTGCAAGGACAAC       c.4200
 G  G  L  G  L  A  I  E  G  P  S  E  A  K  M  S  C  K  D  N         p.1400

          .         .         .         .         .         .       g.21449
 AAGGATGGTAGCTGCACCGTGGAGTACATCCCCTTCACTCCTGGAGACTATGACGTCAAC       c.4260
 K  D  G  S  C  T  V  E  Y  I  P  F  T  P  G  D  Y  D  V  N         p.1420

          .         .         | 25         .         .         .    g.22300
 ATCACCTTCGGGGGGCGGCCCATCCCAG | GGAGCCCGTTCCGCGTGCCAGTGAAGGATGTG    c.4320
 I  T  F  G  G  R  P  I  P  G |   S  P  F  R  V  P  V  K  D  V      p.1440

          .         .         .         .         .         .       g.22360
 GTGGACCCTGGGAAGGTGAAGTGCTCAGGGCCAGGGCTGGGGGCTGGTGTCAGGGCCCGG       c.4380
 V  D  P  G  K  V  K  C  S  G  P  G  L  G  A  G  V  R  A  R         p.1460

          .         .         .         .         .         .       g.22420
 GTTCCTCAGACCTTCACAGTGGACTGCAGTCAAGCTGGCCGGGCGCCCCTGCAGGTGGCT       c.4440
 V  P  Q  T  F  T  V  D  C  S  Q  A  G  R  A  P  L  Q  V  A         p.1480

          .       | 26 .         .         .         .         .    g.22560
 GTGCTGGGCCCCACAG | GTGTGGCCGAGCCTGTGGAGGTGCGGGACAATGGAGATGGCACC    c.4500
 V  L  G  P  T  G |   V  A  E  P  V  E  V  R  D  N  G  D  G  T      p.1500

          .         .         .         .         .         .       g.22620
 CACACTGTCCACTACACCCCAGCCACTGACGGGCCCTACACGGTAGCCGTCAAGTATGCT       c.4560
 H  T  V  H  Y  T  P  A  T  D  G  P  Y  T  V  A  V  K  Y  A         p.1520

          .         . | 27       .         .         .         .    g.23172
 GACCAGGAGGTGCCACGCAG | CCCCTTCAAGATCAAGGTCCTCCCAGCTCATGATGCCAGC    c.4620
 D  Q  E  V  P  R  S  |  P  F  K  I  K  V  L  P  A  H  D  A  S      p.1540

          .         .         .         .         .         .       g.23232
 AAGGTGCGGGCCAGCGGCCCAGGCCTCAACGCCTCTGGCATCCCTGCCAGCCTGCCTGTG       c.4680
 K  V  R  A  S  G  P  G  L  N  A  S  G  I  P  A  S  L  P  V         p.1560

          .         .         .         .         .        | 28.    g.23367
 GAGTTCACCATCGACGCACGGGACGCGGGCGAGGGGTTGCTCACTGTCCAGATCTTG | GAC    c.4740
 E  F  T  I  D  A  R  D  A  G  E  G  L  L  T  V  Q  I  L   | D      p.1580

          .         .         .         .         .         .       g.23427
 CCCGAGGGTAAGCCCAAGAAGGCCAACATCCGGGACAATGGGGATGGCACGTACACTGTG       c.4800
 P  E  G  K  P  K  K  A  N  I  R  D  N  G  D  G  T  Y  T  V         p.1600

          .         .         .         .         .         .       g.23487
 TCCTACCTGCCGGACATGAGTGGCCGGTACACCATCACCATCAAGTATGGCGGTGATGAG       c.4860
 S  Y  L  P  D  M  S  G  R  Y  T  I  T  I  K  Y  G  G  D  E         p.1620

          .         .         .         .         .         .       g.23547
 ATCCCCTACTCGCCCTTCCGCATCCATGCTCTGCCCACTGGGGATGCCAGCAAGTGCCTC       c.4920
 I  P  Y  S  P  F  R  I  H  A  L  P  T  G  D  A  S  K  C  L         p.1640

         | 29.         .         .  | 30      .         .         . g.23931
 GTCACAG | TGTCCATTGGAGGCCATGGCCTGG | GTGCCTGCCTGGGCCCTCGAATCCAGATT c.4980
 V  T  V |   S  I  G  G  H  G  L  G |   A  C  L  G  P  R  I  Q  I   p.1660

          .         .         .         .         .         .       g.23991
 GGGCAGGAGACGGTGATCACGGTGGATGCCAAGGCAGCCGGTGAGGGGAAGGTGACATGC       c.5040
 G  Q  E  T  V  I  T  V  D  A  K  A  A  G  E  G  K  V  T  C         p.1680

          .         .         .         .         .         .       g.24051
 ACGGTGTCCACGCCGGATGGGGCAGAGCTCGATGTGGATGTGGTTGAGAACCATGACGGT       c.5100
 T  V  S  T  P  D  G  A  E  L  D  V  D  V  V  E  N  H  D  G         p.1700

          .         .         .         .         .         .       g.24111
 ACCTTTGACATCTACTACACAGCGCCCGAGCCGGGCAAGTACGTCATCACCATCCGCTTC       c.5160
 T  F  D  I  Y  Y  T  A  P  E  P  G  K  Y  V  I  T  I  R  F         p.1720

          .         .         .          | 31        .         .    g.24568
 GGGGGTGAGCACATCCCCAACAGCCCCTTCCACGTGCTG | GCGTGTGACCCCCTGCCGCAC    c.5220
 G  G  E  H  I  P  N  S  P  F  H  V  L   | A  C  D  P  L  P  H      p.1740

          .         .         .         .         .         .       g.24628
 GAGGAGGAGCCCTCTGAAGTGCCACAGCTGCGCCAGCCCTACGCTCCTCCCCGGCCCGGC       c.5280
 E  E  E  P  S  E  V  P  Q  L  R  Q  P  Y  A  P  P  R  P  G         p.1760

          .         | 32         .         .         .         .    g.24997
 GCCCGCCCCACACACTGG | GCCACAGAGGAGCCAGTGGTGCCTGTGGAGCCAATGGAGTCC    c.5340
 A  R  P  T  H  W   | A  T  E  E  P  V  V  P  V  E  P  M  E  S      p.1780

          .         .         .         .         .         | 33    g.25376
 ATGCTGAGGCCCTTCAACCTGGTCATCCCCTTCGCGGTGCAGAAAGGGGAGCTCACAG | GA    c.5400
 M  L  R  P  F  N  L  V  I  P  F  A  V  Q  K  G  E  L  T  G |       p.1800

          .         .         .         .         .         .       g.25436
 GAGGTGCGGATGCCCTCGGGGAAGACGGCACGGCCCAACATCACCGACAACAAGGACGGC       c.5460
 E  V  R  M  P  S  G  K  T  A  R  P  N  I  T  D  N  K  D  G         p.1820

          .         .         .         .         .         .       g.25496
 ACCATCACGGTGAGGTATGCACCCACTGAGAAAGGCCTGCACCAGATGGGGATCAAGTAT       c.5520
 T  I  T  V  R  Y  A  P  T  E  K  G  L  H  Q  M  G  I  K  Y         p.1840

          .          | 34        .         .         .         .    g.25844
 GACGGCAACCACATCCCTG | GGAGCCCCTTACAGTTCTATGTGGATGCCATCAACAGCCGC    c.5580
 D  G  N  H  I  P  G |   S  P  L  Q  F  Y  V  D  A  I  N  S  R      p.1860

          .         .         .         .         .         .       g.25904
 CATGTCAGTGCCTATGGGCCAGGCCTGAGCCATGGCATGGTCAACAAGCCAGCCACCTTC       c.5640
 H  V  S  A  Y  G  P  G  L  S  H  G  M  V  N  K  P  A  T  F         p.1880

          .         .         | 35         .         .         .    g.26058
 ACTATTGTCACCAAAGATGCTGGAGAAG | GGGGTCTGTCACTGGCCGTGGAGGGCCCATCC    c.5700
 T  I  V  T  K  D  A  G  E  G |   G  L  S  L  A  V  E  G  P  S      p.1900

          .         .         .         .         .         .       g.26118
 AAGGCAGAGATCACCTGTAAGGACAACAAGGATGGCACCTGCACCGTGTCCTATCTGCCG       c.5760
 K  A  E  I  T  C  K  D  N  K  D  G  T  C  T  V  S  Y  L  P         p.1920

          .         .         .         .         .         .       g.26178
 ACTGCGCCTGGAGACTACAGCATCATCGTGCGCTTCGATGACAAGCACATCCCGGGGAGC       c.5820
 T  A  P  G  D  Y  S  I  I  V  R  F  D  D  K  H  I  P  G  S         p.1940

          .         .   | 36     .         .         .         .    g.27200
 CCCTTCACAGCCAAGATCACAG | GTGATGACTCCATGAGGACCTCACAGCTGAATGTGGGC    c.5880
 P  F  T  A  K  I  T  G |   D  D  S  M  R  T  S  Q  L  N  V  G      p.1960

          .         .         .         .         .         .       g.27260
 ACCTCCACGGACGTGTCACTGAAGATCACCGAGAGTGATCTGAGCCAGCTGACCGCCAGC       c.5940
 T  S  T  D  V  S  L  K  I  T  E  S  D  L  S  Q  L  T  A  S         p.1980

          .         .         .         .         .         .       g.27320
 ATCCGTGCCCCCTCGGGCAACGAGGAGCCCTGCCTGCTGAAGCGCCTGCCCAACCGGCAC       c.6000
 I  R  A  P  S  G  N  E  E  P  C  L  L  K  R  L  P  N  R  H         p.2000

      | 37   .         .         .         .         .         .    g.27455
 ATTG | GGATCTCCTTCACCCCCAAGGAGGTCGGGGAGCACGTGGTGAGCGTGCGCAAGAGT    c.6060
 I  G |   I  S  F  T  P  K  E  V  G  E  H  V  V  S  V  R  K  S      p.2020

          .         .         .         .         .         .       g.27515
 GGCAAGCATGTCACCAACAGCCCCTTCAAGATCCTGGTGGGGCCATCTGAGATCGGGGAC       c.6120
 G  K  H  V  T  N  S  P  F  K  I  L  V  G  P  S  E  I  G  D         p.2040

          .         .         .         .         .         .       g.27575
 GCCAGCAAGGTGCGGGTCTGGGGCAAGGGGCTTTCCGAGGGACACACATTCCAGGTGGCA       c.6180
 A  S  K  V  R  V  W  G  K  G  L  S  E  G  H  T  F  Q  V  A         p.2060

          .         .         | 38         .         .         .    g.28072
 GAGTTCATCGTGGACACTCGCAATGCAG | GTTATGGGGGCTTGGGGCTGAGTATTGAAGGC    c.6240
 E  F  I  V  D  T  R  N  A  G |   Y  G  G  L  G  L  S  I  E  G      p.2080

          .         .         .         .         .         .       g.28132
 CCAAGCAAGGTGGACATCAACTGTGAGGACATGGAGGACGGGACATGCAAAGTCACCTAC       c.6300
 P  S  K  V  D  I  N  C  E  D  M  E  D  G  T  C  K  V  T  Y         p.2100

          .         .         .         .         .         .       g.28192
 TGCCCCACCGAGCCCGGCACCTACATCATCAACATCAAGTTTGCTGACAAGCACGTGCCT       c.6360
 C  P  T  E  P  G  T  Y  I  I  N  I  K  F  A  D  K  H  V  P         p.2120

   | 39      .         .         .         .         .         .    g.28345
 G | GAAGCCCCTTCACTGTGAAGGTGACCGGCGAGGGCCGCATGAAGGAGAGCATCACCCGG    c.6420
 G |   S  P  F  T  V  K  V  T  G  E  G  R  M  K  E  S  I  T  R      p.2140

          .         .         .         .         .         .       g.28405
 CGGAGACAGGCACCTTCCATCGCCACCATCGGCAGCACCTGTGACCTCAACCTCAAGATC       c.6480
 R  R  Q  A  P  S  I  A  T  I  G  S  T  C  D  L  N  L  K  I         p.2160

      | 40   .         .         .         .         .         .    g.28601
 CCAG | GAAACTGGTTCCAGATGGTGTCTGCCCAGGAGCGCCTGACACGCACCTTCACACGC    c.6540
 P  G |   N  W  F  Q  M  V  S  A  Q  E  R  L  T  R  T  F  T  R      p.2180

          .         .         .         .         .         .       g.28661
 AGCAGCCACACCTACACCCGCACGGAGCGCACGGAGATCAGCAAGACGCGGGGCGGGGAG       c.6600
 S  S  H  T  Y  T  R  T  E  R  T  E  I  S  K  T  R  G  G  E         p.2200

          .         .         .         .         .         .       g.28721
 ACAAAGCGCGAGGTGCGGGTGGAGGAGTCCACCCAGGTCGGCGGGGACCCCTTCCCTGCT       c.6660
 T  K  R  E  V  R  V  E  E  S  T  Q  V  G  G  D  P  F  P  A         p.2220

          .         .         .         .         .         .       g.28781
 GTGTTTGGGGACTTCCTGGGCCGGGAGCGCCTGGGATCCTTCGGCAGCATCACCCGGCAG       c.6720
 V  F  G  D  F  L  G  R  E  R  L  G  S  F  G  S  I  T  R  Q         p.2240

         | 41.         .         .         .         .         .    g.29037
 CAGGAGG | GTGAGGCCAGCTCTCAGGACATGACTGCACAGGTGACCAGCCCATCGGGCAAG    c.6780
 Q  E  G |   E  A  S  S  Q  D  M  T  A  Q  V  T  S  P  S  G  K      p.2260

          .         .         .         .         .         .       g.29097
 GTGGAAGCCGCAGAGATCGTCGAGGGCGAGGACAGCGCCTACAGCGTGCGCTTTGTGCCC       c.6840
 V  E  A  A  E  I  V  E  G  E  D  S  A  Y  S  V  R  F  V  P         p.2280

          .         .         .         .         .         .       g.29157
 CAGGAAATGGGGCCCCATACGGTCGCTGTCAAGTACCGTGGCCAGCACGTGCCCGGCAGC       c.6900
 Q  E  M  G  P  H  T  V  A  V  K  Y  R  G  Q  H  V  P  G  S         p.2300

          .         .         .         .         .         .       g.29217
 CCCTTTCAGTTCACTGTGGGGCCGCTGGGTGAAGGTGGTGCCCACAAGGTGCGGGCCGGA       c.6960
 P  F  Q  F  T  V  G  P  L  G  E  G  G  A  H  K  V  R  A  G         p.2320

          .         .         .        | 42.         .         .    g.29369
 GGCACAGGGCTGGAGCGAGGTGTGGCCGGCGTGCCAG | CCGAGTTCAGCATCTGGACCCGG    c.7020
 G  T  G  L  E  R  G  V  A  G  V  P  A |   E  F  S  I  W  T  R      p.2340

          .         .         .         .         .         .       g.29429
 GAGGCTGGCGCTGGGGGCCTGTCCATTGCTGTGGAGGGTCCTAGCAAAGCGGAGATTGCA       c.7080
 E  A  G  A  G  G  L  S  I  A  V  E  G  P  S  K  A  E  I  A         p.2360

          .         .         .         .         .      | 43  .    g.29775
 TTTGAGGATCGCAAAGATGGCTCCTGCGGCGTCTCCTATGTCGTCCAGGAACCAG | GTGAC    c.7140
 F  E  D  R  K  D  G  S  C  G  V  S  Y  V  V  Q  E  P  G |   D      p.2380

          .         .         .         .         .         .       g.29835
 TATGAGGTCTCCATCAAGTTCAATGATGAGCACATCCCAGACAGCCCCTTTGTGGTGCCT       c.7200
 Y  E  V  S  I  K  F  N  D  E  H  I  P  D  S  P  F  V  V  P         p.2400

          .         .         .         .         .  | 44      .    g.31098
 GTGGCCTCCCTCTCGGATGACGCTCGCCGTCTCACTGTCACCAGCCTCCAG | GAGACGGGG    c.7260
 V  A  S  L  S  D  D  A  R  R  L  T  V  T  S  L  Q   | E  T  G      p.2420

          .         .         .         .         .         .       g.31158
 CTCAAGGTGAACCAGCCAGCGTCCTTTGCCGTGCAGCTGAACGGTGCCCGGGGCGTGATT       c.7320
 L  K  V  N  Q  P  A  S  F  A  V  Q  L  N  G  A  R  G  V  I         p.2440

          .         .         .         .         .         .       g.31218
 GATGCCCGGGTGCACACACCCTCGGGGGCTGTGGAGGAGTGCTACGTCTCTGAGCTGGAC       c.7380
 D  A  R  V  H  T  P  S  G  A  V  E  E  C  Y  V  S  E  L  D         p.2460

      | 45   .         .         .         .         .         .    g.31372
 AGTG | ACAAGCACACCATCCGCTTCATCCCCCACGAGAATGGCGTCCACTCCATCGATGTC    c.7440
 S  D |   K  H  T  I  R  F  I  P  H  E  N  G  V  H  S  I  D  V      p.2480

          .         .         .         .         .         .       g.31432
 AAGTTCAACGGTGCCCACATCCCTGGAAGTCCCTTCAAGATCCGCGTTGGGGAGCAGAGC       c.7500
 K  F  N  G  A  H  I  P  G  S  P  F  K  I  R  V  G  E  Q  S         p.2500

          .         .         .         .         .         .       g.31492
 CAGGCTGGGGACCCAGGCTTGGTGTCAGCCTACGGTCCTGGGCTCGAGGGAGGCACTACC       c.7560
 Q  A  G  D  P  G  L  V  S  A  Y  G  P  G  L  E  G  G  T  T         p.2520

   | 46      .         .         .         .         .         .    g.31748
 G | GTGTGTCATCAGAGTTCATCGTGAACACCCTGAATGCCGGCTCGGGGGCCTTGTCTGTC    c.7620
 G |   V  S  S  E  F  I  V  N  T  L  N  A  G  S  G  A  L  S  V      p.2540

          .         .         .         .         .         .       g.31808
 ACCATTGATGGCCCCTCCAAGGTGCAGCTGGACTGTCGGGAGTGTCCTGAGGGCCATGTG       c.7680
 T  I  D  G  P  S  K  V  Q  L  D  C  R  E  C  P  E  G  H  V         p.2560

          .         .         .         .         .         .       g.31868
 GTCACTTATACTCCCATGGCCCCTGGCAACTACCTCATTGCCATCAAGTACGGTGGCCCC       c.7740
 V  T  Y  T  P  M  A  P  G  N  Y  L  I  A  I  K  Y  G  G  P         p.2580

          .         .         .         . | 47       .         .    g.32599
 CAGCACATCGTGGGCAGCCCCTTCAAGGCCAAGGTCACTG | GTCCGAGGCTGTCCGGAGGC    c.7800
 Q  H  I  V  G  S  P  F  K  A  K  V  T  G |   P  R  L  S  G  G      p.2600

          .         .         .         .         .         .       g.32659
 CACAGCCTTCACGAAACATCCACGGTTCTGGTGGAGACTGTGACCAAGTCCTCCTCAAGC       c.7860
 H  S  L  H  E  T  S  T  V  L  V  E  T  V  T  K  S  S  S  S         p.2620

          .         .         .         .         .         .       g.32719
 CGGGGCTCCAGCTACAGCTCCATCCCCAAGTTCTCCTCAGATGCCAGCAAGGTGGTGACT       c.7920
 R  G  S  S  Y  S  S  I  P  K  F  S  S  D  A  S  K  V  V  T         p.2640

          .         .         .         .         .         .       g.32779
 CGGGGCCCTGGGCTGTCCCAGGCCTTCGTGGGCCAGAAGAACTCCTTCACCGTGGACTGC       c.7980
 R  G  P  G  L  S  Q  A  F  V  G  Q  K  N  S  F  T  V  D  C         p.2660

          . | 48       .         .         .         .         .    g.32957
 AGCAAAGCAG | GCACCAACATGATGATGGTGGGCGTGCACGGCCCCAAGACCCCCTGTGAG    c.8040
 S  K  A  G |   T  N  M  M  M  V  G  V  H  G  P  K  T  P  C  E      p.2680

          .         .         .         .         .         .       g.33017
 GAGGTGTACGTGAAGCACATGGGGAACCGGGTGTACAATGTCACCTACACTGTCAAGGAG       c.8100
 E  V  Y  V  K  H  M  G  N  R  V  Y  N  V  T  Y  T  V  K  E         p.2700

          .         .         .         .         .         .       g.33077
 AAAGGGGACTACATCCTCATTGTCAAGTGGGGTGACGAAAGTGTCCCTGGAAGCCCCTTC       c.8160
 K  G  D  Y  I  L  I  V  K  W  G  D  E  S  V  P  G  S  P  F         p.2720

          .                                                         g.33095
 AAAGTCAAGGTCCCTTGA                                                 c.8178
 K  V  K  V  P  X                                                   p.2725

          .         .         .         .         .         .       g.33155
 atcccaaaagtgcctccccagcctcagcccccacctccagccacacacacattacacaca       c.*60

          .         .         .         .         .         .       g.33215
 cacacacacacacacaaatgtgccacacccagacacgcacagaatcagacactacaaaca       c.*120

          .         .         .         .         .         .       g.33275
 cctgccttgggggtgaagtgaaggcccagcctccccaccccaccgcgccccaggggttgg       c.*180

          .         .         .         .         .         .       g.33335
 aggaccttgtctgtgtcaggacagtgtccctccctgggaatgtgacatgagggccgactg       c.*240

          .         .         .         .         .         .       g.33395
 gggccaggctcaggggcagaggctgggacacaaggggctggcgagggctgcgaggccagg       c.*300

          .         .         .         .         .         .       g.33455
 gaagccctgagtttctggcggggctgagcagtgggggagcattgtgttgtgggtgtctgt       c.*360

          .         .         .         .         .         .       g.33515
 gtgtgaggtcaccctcaaactgcaccgccggccagataccctcctgaccccgaggacttg       c.*420

          .         .         .         .         .         .       g.33575
 gtctggtctctctggtggctacaaccccagagttttaaggacttggaaaggaaagcacaa       c.*480

          .         .         .         .         .         .       g.33635
 tcagagaagaaaacagcccccgaaccagcaggagtggcctggcacatggaccggcctgag       c.*540

          .         .         .         .         .         .       g.33695
 cgatgtgcactccacccaagccaggctcccagggggcctgatttctctctcactgtctct       c.*600

          .         .         .         .         .         .       g.33755
 ttttttaaaatggttgcacggctctgccccatggggggccttttttacacactgcgaggc       c.*660

          .         .         .         .         .         .       g.33815
 ccagctttctaggggacttttgcacatgtcatgcagctcagctgggagctgcttaggtgg       c.*720

          .         .         .                                     g.33846
 aaaactccaaataaagtgcggctgtcgcaga                                    c.*751

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Filamin C, gamma protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center