forkhead box I1 (FOXI1) - coding DNA reference sequence

(used for variant description)

(last modified September 9, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_012188.4 in the FOXI1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012068.1, covering FOXI1 transcript NM_012188.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5045
                gggtgcaggtgccaggcaggtggctccggccagcccagccccagc       c.-1

          .         .         .         .         .         .       g.5105
 ATGAGCTCCTTCGACCTGCCGGCGCCCTCCCCACCTCGCTGCAGCCCCCAGTTCCCCAGC       c.60
 M  S  S  F  D  L  P  A  P  S  P  P  R  C  S  P  Q  F  P  S         p.20

          .         .         .         .         .         .       g.5165
 ATCGGCCAGGAGCCCCCCGAGATGAACCTCTACTATGAGAACTTCTTCCACCCACAGGGC       c.120
 I  G  Q  E  P  P  E  M  N  L  Y  Y  E  N  F  F  H  P  Q  G         p.40

          .         .         .         .         .         .       g.5225
 GTGCCCAGCCCTCAGCGGCCCTCCTTCGAGGGGGGCGGCGAGTATGGGGCCACCCCCAAC       c.180
 V  P  S  P  Q  R  P  S  F  E  G  G  G  E  Y  G  A  T  P  N         p.60

          .         .         .         .         .         .       g.5285
 CCCTACCTCTGGTTCAACGGGCCCACCATGACCCCGCCACCCTACCTGCCCGGCCCCAAC       c.240
 P  Y  L  W  F  N  G  P  T  M  T  P  P  P  Y  L  P  G  P  N         p.80

          .         .         .         .         .         .       g.5345
 GCCAGCCCCTTCCTGCCCCAGGCCTATGGAGTGCAGAGGCCGCTGCTGCCCAGCGTGTCG       c.300
 A  S  P  F  L  P  Q  A  Y  G  V  Q  R  P  L  L  P  S  V  S         p.100

          .         .         .         .         .         .       g.5405
 GGGCTTGGGGGGAGCGACCTGGGCTGGCTGCCCATCCCCTCGCAGGAGGAGCTGATGAAG       c.360
 G  L  G  G  S  D  L  G  W  L  P  I  P  S  Q  E  E  L  M  K         p.120

          .         .         .         .         .         .       g.5465
 CTGGTGCGGCCACCCTATTCCTACTCGGCTCTCATCGCCATGGCCATCCACGGGGCACCC       c.420
 L  V  R  P  P  Y  S  Y  S  A  L  I  A  M  A  I  H  G  A  P         p.140

          .         .         .         .         .         .       g.5525
 GACAAGCGCCTCACTCTCAGCCAGATCTACCAGTACGTGGCCGACAACTTCCCCTTCTAC       c.480
 D  K  R  L  T  L  S  Q  I  Y  Q  Y  V  A  D  N  F  P  F  Y         p.160

          .         .         .         .         .         .       g.5585
 AACAAGAGCAAGGCCGGCTGGCAGAACTCCATCCGCCACAACCTGTCGCTCAACGACTGC       c.540
 N  K  S  K  A  G  W  Q  N  S  I  R  H  N  L  S  L  N  D  C         p.180

          .         .         .     | 02   .         .         .    g.7162
 TTCAAGAAGGTGCCCCGCGACGAGGACGACCCGG | GCAAAGGGAATTACTGGACCCTGGAC    c.600
 F  K  K  V  P  R  D  E  D  D  P  G |   K  G  N  Y  W  T  L  D      p.200

          .         .         .         .         .         .       g.7222
 CCCAACTGTGAGAAAATGTTCGACAATGGAAATTTCCGCAGGAAAAGGAAGAGAAAATCA       c.660
 P  N  C  E  K  M  F  D  N  G  N  F  R  R  K  R  K  R  K  S         p.220

          .         .         .         .         .         .       g.7282
 GATGTTTCCTCTAGCACAGCCTCCTTGGCCTTAGAGAAGACAGAGAGCAGTCTCCCGGTG       c.720
 D  V  S  S  S  T  A  S  L  A  L  E  K  T  E  S  S  L  P  V         p.240

          .         .         .         .         .         .       g.7342
 GACAGCCCCAAGACCACGGAGCCTCAGGACATCTTGGATGGAGCCTCACCAGGGGGCACC       c.780
 D  S  P  K  T  T  E  P  Q  D  I  L  D  G  A  S  P  G  G  T         p.260

          .         .         .         .         .         .       g.7402
 ACCAGCTCCCCAGAGAAGCGGCCCTCCCCTCCCCCATCAGGCGCCCCTTGCCTTAACAGC       c.840
 T  S  S  P  E  K  R  P  S  P  P  P  S  G  A  P  C  L  N  S         p.280

          .         .         .         .         .         .       g.7462
 TTCCTTTCCTCTATGACAGCCTATGTGAGCGGGGGGAGCCCCACGAGCCACCCCTTGGTC       c.900
 F  L  S  S  M  T  A  Y  V  S  G  G  S  P  T  S  H  P  L  V         p.300

          .         .         .         .         .         .       g.7522
 ACACCAGGACTGAGCCCTGAGCCCAGTGACAAGACGGGGCAGAACTCACTGACCTTCAAC       c.960
 T  P  G  L  S  P  E  P  S  D  K  T  G  Q  N  S  L  T  F  N         p.320

          .         .         .         .         .         .       g.7582
 TCCTTCTCCCCGCTCACCAACCTCAGCAACCACAGCGGTGGGGGTGACTGGGCGAACCCC       c.1020
 S  F  S  P  L  T  N  L  S  N  H  S  G  G  G  D  W  A  N  P         p.340

          .         .         .         .         .         .       g.7642
 ATGCCCACCAACATGCTCAGCTATGGAGGATCTGTGCTCAGCCAATTCAGCCCTCACTTC       c.1080
 M  P  T  N  M  L  S  Y  G  G  S  V  L  S  Q  F  S  P  H  F         p.360

          .         .         .         .         .                 g.7699
 TACAACAGTGTCAACACCAGTGGTGTCCTCTACCCCAGGGAGGGCACCGAGGTCTAG          c.1137
 Y  N  S  V  N  T  S  G  V  L  Y  P  R  E  G  T  E  V  X            p.378

          .         .         .         .         .         .       g.7759
 gtacagaacagctcctgagccaggtggacatgccagagagaaaagcagtagaggtcctcc       c.*60

          .         .         .         .         .         .       g.7819
 atgccagccccacggtggtccatgactgcggaactgcccagacataagcaggagcctccg       c.*120

          .         .         .         .         .         .       g.7879
 aggaatccaccctctttctagaacactggttaaggcttctgtttatcacacataggccca       c.*180

          .         .         .         .         .         .       g.7939
 cacacagactcaccaactttgcaatagaaatactggtgcctgcagagcagcactaacagt       c.*240

          .         .         .         .         .         .       g.7999
 ggcaggtgctgtactaggctctgtactggccacacttactattgacagtcaccccgtaag       c.*300

          .         .         .         .         .         .       g.8059
 gttcacaaaccaccccattgaacagatgaggaactgaggctcaaggaggttaagtaacat       c.*360

          .         .         .         .         .         .       g.8119
 ttccagggttatataaactagtaaatggcagagctaagagtcaaatccaggtctatgtga       c.*420

          .         .         .         .         .         .       g.8179
 tcctcagagattggaggccgggatggagaattggttgagtagccaaggaaggtcagtgtg       c.*480

          .         .         .         .         .         .       g.8239
 aaaagcttgctatggcaaatatagcgaaatctctccactgccttctgtccaccaacattt       c.*540

          .         .         .         .         .         .       g.8299
 agtgccagcctaggcacaacttgtcctggtccaagtccttattctgcttgccccaactta       c.*600

          .         .         .         .         .         .       g.8359
 cctgcagacactccttttgctaccactcaaggaaggaagtcaccagtggccttagtgcag       c.*660

          .         .         .         .         .         .       g.8419
 gaaactcagccctggtggccctgcagaacaatgcatctgacatgtgcgatgcatccccat       c.*720

          .         .         .         .         .         .       g.8479
 ggagagacagcattgctccccagccctccagaaaccttgagcagatccagggatcagtga       c.*780

          .         .         .         .         .         .       g.8539
 gaggagtggtgtgtacccctaaatcctcccaccccagcactgcccatctgtaaaatcttg       c.*840

          .         .         .         .         .         .       g.8599
 taaagcccagtttcctgtgtgcatgtcatggaccagtgagctggagatggctgaatcttc       c.*900

          .         .         .         .         .         .       g.8659
 caagagaaacaaggttggataagcgcttccttttttttagcccaggagaggtggatgttt       c.*960

          .         .         .         .         .         .       g.8719
 gtctgagaaaacaatggcctcaagggaggggccttgggcccaccctcacagggggtctct       c.*1020

          .         .         .         .         .         .       g.8779
 gtgtgatctcttgggatttctccttgtttttgtgagtacctgggaagtgttgtttgtttt       c.*1080

          .         .         .                                     g.8813
 cttattttctttttaattaaaaaacaaacaaaca                                 c.*1114

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Forkhead box I1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center