forkhead box N1 (FOXN1) - downstream reference sequence


            .         .         .         .         .         . g.19276
a / catctacccgggcaccaaactgagcccaattccgaagcagtgtttggaaaagcccttgc c.*780

         .         .         .         .         .         .    g.19336
cctcggaaacttgaacatgtcctttttccccagtcccgggtgcaggaagggccccctcca    c.*840

         .         .         .         .         .         .    g.19396
ggtcaccacaatctcactcctcctccagaaagaaaagttcacatagtttaggtcctggct    c.*900

         .         .         .         .         .         .    g.19456
taactctacttatgatggttcaacttacactttttcaactttaagatggtgcaaaagcaa    c.*960

         .         .         .         .         .         .    g.19516
tacacattcagtatgttcctcgacttaggatgcggttatgtccgataaacccattgtaaa    c.*1020

         .         .         .         .         .         .    g.19576
ttgaaaccaccgaaagtcaaaaaccactttcgacttacgatgtttcccactcacgatggg    c.*1080

         .         .         .         .         .         .    g.19636
tttctccggatgtagccccatcataagttgaggagcacctgttagttacttccaactgtc    c.*1140

         .         .         .         .         .         .    g.19696
tcaggcaacctgggcattcaggagaaaagcctggcacagggtgacagggaagcacccatg    c.*1200

         .         .         .         .         .         .    g.19756
caaagcacccccgctttgactgcttggcagacctagggtgcccgggaagcacaagggata    c.*1260

         .         .         .         .         .         .    g.19816
cccttggccctgcggggtgtggcccaggtgcctgccatgagcctgaccccatcgaggggg    c.*1320

         .         .         .         .         .         .    g.19876
aacctcagcccaccctgggcctgggggtgacaagaacttccacaggttggccccaggctt    c.*1380

         .         .         .         .         .         .    g.19936
ataggaggcataagcagatcccgcgatggcttgtcattgtcccctgtcctggaacaataa    c.*1440

         .         .         .         .         .         .    g.19996
agcaagtgccttgtggtctcactaccaagctttcatttctggcccctctccctaagcaaa    c.*1500

         .         .         .         .         .         .    g.20056
atggccaggccacactgatggcagatgccctgggcctgtgacgtccctgtcaccctcacc    c.*1560

         .         .         .         .         .         .    g.20116
cagaactaggaagtttctaatccaaagagtgaggcatctaggaaaacttcttgacccact    c.*1620

         .         .         .         .         .         .    g.20176
ggggaggctgaggagcaggtgagcagggcctcttcccaggagaacttccaaagagatgca    c.*1680

         .         .         .         .         .         .    g.20236
gggaagaggctgccctggccagaggaatggaggggatgccctcccccagaccccttgcct    c.*1740

         .         .         .         .         .         .    g.20296
ctgaggtctgcccactccctctttgcacccccatctcctcacacaagaaggagttgctgc    c.*1800

         .         .         .         .         .         .    g.20356
cctgtccaaactgtgcctttctgcttccaatctgtccctggctgaaagagatgccaagtg    c.*1860

         .         .         .         .         .         .    g.20416
gtttggggccctgagttccacaggtgacaaaatggagcatgccctggtgctgtgtgcact    c.*1920

         .         .         .         .         .         .    g.20476
gctggtcctggagagtggtctctggatggtcaggggctcactcagtcccacttcagactc    c.*1980

         .         .         .         .         .         .    g.20536
accccctaggtgtcacctccaggtggggttggtgtcaccgcagcactgtctcaagagaga    c.*2040

         .         .         .         .         .         .    g.20596
tggggcagatgtgggagccaaaagcacatacatgatccccaggtcccagagcagccacaa    c.*2100

         .         .         .         .         .         .    g.20656
gtggtgtctctgcttagaaagctcttcttggatgaaggctgggcacggtggctcacgcct    c.*2160

         .         .         .         .         .         .    g.20716
gtaatcccagcactttgggaggcccaggcaggcagattacctgaggttgggagttcaaga    c.*2220

         .         .         .         .         .         .    g.20776
ccagcctggccaaaatggtgaaacctcatctctactaaaaatacaaaaattagctgggcg    c.*2280

         .         .         .         .         .         .    g.20836
tggtggtggacgcctgtaatcccaggtactcaggagggaggctgaggcaggagaatcgct    c.*2340

         .         .         .         .         .         .    g.20896
tgaacccgggaggcagaggttgcagtgagccgagattggaccactgcacaccagcctggg    c.*2400

         .         .         .         .         .         .    g.20956
caacagagtgagactctgtctcaaaaaaaagaaaagaaagcacttcttggatggctaggc    c.*2460

         .         .         .         .         .         .    g.21016
acagtggctcatgcctgtaatcccagcactttgggaggccgagatgggtggatcacttga    c.*2520

         .         .         .         .         .         .    g.21076
tatcaggagttcgagaccagcctgagcaacatggtgaaaccctgcctctgctaaaaatac    c.*2580

         .         .         .         .         .         .    g.21136
aaaaattagctgagtgtgctggtgggcacctttaatcccagttactcaggaggctgaggc    c.*2640

         .         .         .         .         .         .    g.21196
aggagaatcacttgaacctgggaggtggaagttgcagtgagctgagattgtgccactgca    c.*2700

         .         .                                            g.21217
ctccagcctgggtgacagagt                                           c.*2721


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center