forkhead box N1 (FOXN1) - 410 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5212
gtaagtacccggcatctgggcctgggtttaggccaaggcctgcggctgcccaggcaacaa  c.123+60

         .         .         .         .         .         .  g.5272
gaagaccagtcaccttaccgcccccagggacctcccagggcctgtcttgtcccctccacc  c.123+120

         .         .         .         .         .         .  g.5332
agcaaacaagtcctcagggaccccgagatccagaggggtcactcctcatcccttcagtct  c.123+180

         .         .       g.5357
gagcctgtcccagggctgtgagccc  c.123+205

--------------------- middle of intron ---------------------
                        g.5358          .         .           g.5382
                        c.124-205  catcagatttggggtaccccaggtt  c.124-181

.         .         .         .         .         .           g.5442
tcatggcagggtgccctcatgaaatcggggccaagggtaggctatttcttctccaccatt  c.124-121

.         .         .         .         .         .           g.5502
tagggtcttcccagagctcagccatagaccccctttaccccagaacagagtagggtccca  c.124-61

.         .         .         .         .         .           g.5562
gccagtccccaggcctggttcagcctccactcacaggctcgctactctctgtctacccag  c.124-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center