forkhead box N1 (FOXN1) - 2283 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6087
gtgagtactagtggccagcgagtgtcccatcttcccactgtcccagttcctagcagccta  c.588+60

         .         .         .         .         .         .  g.6147
gaaagagtcagacctctgagaccaaagtcccaccttctctttgcagaccttgccactcaa  c.588+120

         .         .         .         .         .         .  g.6207
gaccagagagttggggcctcctggtcagctggggaggggtgttggcctggccagcatgga  c.588+180

         .         .         .         .         .         .  g.6267
ggggggcaagtgggggaggtaggccaggctaaagaagctggcagcttcccagaggctcct  c.588+240

         .         .         .         .         .         .  g.6327
gagtcaggattccagtgtgtgacttctcactgtttgtttaaatgtccagaaactccagcc  c.588+300

         .         .         .         .         .         .  g.6387
agacctacacacccatatgcaaatgtgacaagaaaaacacattccagaggccaagggaaa  c.588+360

         .         .         .         .         .         .  g.6447
gggtttggggaggagccatagtacacagtttttccctccccagccttagcatacagagtt  c.588+420

         .         .         .         .         .         .  g.6507
gagagaggactttaagtgtggagggacccttcctggccccattctttgcccagagtgggg  c.588+480

         .         .         .         .         .         .  g.6567
cctgggtgtattcctggaaataccttggaaggttaacatgtccttccatagcctgacctc  c.588+540

         .         .         .         .         .         .  g.6627
cataagcggcgtgaccctggacaagtcttaacgtctctgagcctcatctgaaaagtaagg  c.588+600

         .         .         .         .         .         .  g.6687
tcaacattacctgtctcatgggattgttgcttagggaagataaaagctaaagggaatttg  c.588+660

         .         .         .         .         .         .  g.6747
ctccctgctcccccgctctggtttggaggtccctgaggcagtgactgagtgggcgtagcc  c.588+720

         .         .         .         .         .         .  g.6807
tcagcagtgcctactccacatgcccaccagcccccctcacctcttgctttcaaacaggcc  c.588+780

         .         .         .         .         .         .  g.6867
cccattccagccccaagccaccccaacaaaggcttagaaggaagatggagaaggcggttg  c.588+840

         .         .         .         .         .         .  g.6927
ggtcctaccaggtgtggccaaaacaggactttattctggccctttgaccacttcttctca  c.588+900

         .         .         .         .         .         .  g.6987
ggccccttaaacatgaccacagcctacagatagggcaccatcatctcagctactgccccc  c.588+960

         .         .         .         .         .         .  g.7047
aaacctccactcaataacagctgccaatcattctgccaggtgctttctttcaagtgcccc  c.588+1020

         .         .         .         .         .         .  g.7107
catttaatcccctcaacaacactctagagagttcccaccatacccgtgttgcagatgagg  c.588+1080

         .         .         .         .         .         .  g.7167
aaactgaggctcatagaggccaagtgacttgcccagggtgtctcctaacctgcaaatggt  c.588+1140

    g.7169
ga  c.588+1142

--------------------- middle of intron ---------------------
                                               g.7170         g.7170
                                               c.589-1141  g  c.589-1141

.         .         .         .         .         .           g.7230
gctgagattgagttcacacccttgccctcccacacatggagaagagctccagagacacac  c.589-1081

.         .         .         .         .         .           g.7290
aggtatctggtcgacttgctgggtgaccttgggcatattgcttcccctctttgggctcag  c.589-1021

.         .         .         .         .         .           g.7350
ccccatcatctgtcaaatgaaggggttggacacaagtgctcttggcccttctaggcccga  c.589-961

.         .         .         .         .         .           g.7410
gattctatgattatggcaatctctgcatcaacaaccccagggcacacccagagagaggtc  c.589-901

.         .         .         .         .         .           g.7470
acagctgatttgcccctctgggcccagatgctggtttcccaaggcccctggtaaccccag  c.589-841

.         .         .         .         .         .           g.7530
gaagtgcaatccgcctcctccagggcttgtccaccttccggggcctagctgcacaccctc  c.589-781

.         .         .         .         .         .           g.7590
ctgtccgtactcaccggagagctctgcactaggccctgggactctgtgccggcctctcac  c.589-721

.         .         .         .         .         .           g.7650
acatgggaaggcggagtctggccatcatggctagcagcagctgcaggctccccatgccca  c.589-661

.         .         .         .         .         .           g.7710
gtgtgagagcatccacaggactcacgcaggccagcaactgtgcagactccctggagcagg  c.589-601

.         .         .         .         .         .           g.7770
gagcaaaagctctgcatcagggatggccaggagtcagagcggagaggagttactagcccc  c.589-541

.         .         .         .         .         .           g.7830
attcagagatcctgctggagcttcctggggctgtacagaggaggaaacagaagggaccca  c.589-481

.         .         .         .         .         .           g.7890
ggcccacagctggaccagcctgtctggccactacccatgctcccctcaccatggatcctc  c.589-421

.         .         .         .         .         .           g.7950
agggagagttctggagctgtgaccttttcctggtgtcctttgcacacctactcagagggt  c.589-361

.         .         .         .         .         .           g.8010
ctgagacctctgagtcaggcgtgtcgagtgaggtcagcaccgtgcctttgtgctattcca  c.589-301

.         .         .         .         .         .           g.8070
gaagatccctgtccctaccccagcacaagtctccctgacttctcaggacagcccagcctc  c.589-241

.         .         .         .         .         .           g.8130
agcctctcccctgccgtgaggggaggcgtagggactgctgtcagttccagccccggctct  c.589-181

.         .         .         .         .         .           g.8190
accactaaattgctgagttcccttgggaaaatctctgcccttctctgttctctgttgttc  c.589-121

.         .         .         .         .         .           g.8250
tccaggaataagctttgggggaagcagaataggggttgcttttatgtaaggttcaagaca  c.589-61

.         .         .         .         .         .           g.8310
caggaaagaggaagggagaaaataaggcctaatctagtcatctgctttctcttccagcag  c.589-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center