forkhead box N1 (FOXN1) - 1732 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.8481
gtgggtctggggcaagtgggcctgcttcccccaggtctgaggatatcgtgtgtgtgtatg  c.699+60

         .         .         .         .         .         .  g.8541
tggtgtgtgggtgtctatgtgatggcatgtgttcaccaggataggcagataaggacagca  c.699+120

         .         .         .         .         .         .  g.8601
gggccctgaaccttaggcttggccacagcaggtggcgggaatagttaatgggaagagaag  c.699+180

         .         .         .         .         .         .  g.8661
caattgccctcctccaggggtgggcttgtctgagtccctggcaaggcctgagaggcctca  c.699+240

         .         .         .         .         .         .  g.8721
gataagagtgtggggctgagatggaggcagggctgtgatgtgagccagaaatgggggaag  c.699+300

         .         .         .         .         .         .  g.8781
gaggagagctgccccagacagagagaggggcaaagaggagtgtggtgtgaaacacaggcc  c.699+360

         .         .         .         .         .         .  g.8841
gagcaggtcgaggaacaagggcttctgtatagtcagccaccatcttgctatgtgaccttg  c.699+420

         .         .         .         .         .         .  g.8901
gcctccaacttctattagcctagaaagggtgggcacccagtgtgggcttaggggaccttc  c.699+480

         .         .         .         .         .         .  g.8961
ccacccagaggactccaagtccccatcatcttcagccctttcctcctttcccagcttcag  c.699+540

         .         .         .         .         .         .  g.9021
ctcctcccaagtgtataggatgccaagtaattgccccacactggcatgggatggaggagt  c.699+600

         .         .         .         .         .         .  g.9081
tttaaaggagaaagaaaagagccccagagcagccaggcagctcccaggagtcaccaggca  c.699+660

         .         .         .         .         .         .  g.9141
agacagagcaagtggctgcccagcgcccagctccatccacctgcagcctggcactgagac  c.699+720

         .         .         .         .         .         .  g.9201
aggccctgcctgtggagcaggttctgcacccggctctctggcactggccctgatctcagc  c.699+780

         .         .         .         .         .         .  g.9261
caagccagggaggaaggcaagggagaggggctgggtcagactgctggctttgcagggaaa  c.699+840

         .         .        g.9287
agaaagagatagagggaagcaaagag  c.699+866

--------------------- middle of intron ---------------------
                       g.9288           .         .           g.9313
                       c.700-866  aaggcatgagaggacatcctctctgc  c.700-841

.         .         .         .         .         .           g.9373
catgaggggcctgggtggaatgaccgaagctatcctgaggctcatggtctgacccagggt  c.700-781

.         .         .         .         .         .           g.9433
agaggatgtccctgaggcagggacagagattgagccacagaaggactaaggggccaccag  c.700-721

.         .         .         .         .         .           g.9493
accttaaatgacctcaccatgcctggccctgctttgatggcctctgcagtctgcaccccc  c.700-661

.         .         .         .         .         .           g.9553
tctcaagatggccacacccagggctttatggagcctggaccgaggtgactcaggcactaa  c.700-601

.         .         .         .         .         .           g.9613
atgtctcttgggtaacctggaaagagctcttcagcctggagcagctgggggagtcagagt  c.700-541

.         .         .         .         .         .           g.9673
ctcctacccccatcccccataaaacaccatccgtggcaccgcagccactccctttgccgt  c.700-481

.         .         .         .         .         .           g.9733
aaaaccacctcctaccccgacctgtccaccaccatgactggccctttcaaagagccactg  c.700-421

.         .         .         .         .         .           g.9793
aaactcataaaaggtggcagtgcccagcaaacgcccaggctggacatcctgcttccggcc  c.700-361

.         .         .         .         .         .           g.9853
cagctgctctgggagatgcacaggcactgggagcaccttcctggaagggtgcaggggccg  c.700-301

.         .         .         .         .         .           g.9913
agggcttcacttcatactctccctgcagggtcccgtcaccatagcaaccagagcatcaaa  c.700-241

.         .         .         .         .         .           g.9973
agggctgagaggaaggagctggaggaagagggttttaaggcctctgagatcctgaattac  c.700-181

.         .         .         .         .         .           g.10033
agggtgtggatctcctcacagcccctcagacagctctgctttgggggtgatggggcccat  c.700-121

.         .         .         .         .         .           g.10093
gacccaggagggaagaatctggcctgagccccttctctggatgtatataaatggggagga  c.700-61

.         .         .         .         .         .           g.10153
gggccctcctgggaaaggctgggtaccatgcaatcactctgccccttttgacctcctcag  c.700-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center