forkhead box N1 (FOXN1) - 1524 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.10344
gtacatttcccactctccagggatgggaggaggaggggagtgagagggcccctgggaaca  c.830+60

         .         .         .         .         .         .  g.10404
ctgaggcatggaatcctctgggtctaccagtaatggcagcaggtggaaatcataccagtg  c.830+120

         .         .         .         .         .         .  g.10464
ggcttccagaagatgctggagagagggttcctgcatgaaggcaggggcatagactggatc  c.830+180

         .         .         .         .         .         .  g.10524
agctctgaccctttgtctaagcctggggagtcatgtctgtgacttgactcagcagatgct  c.830+240

         .         .         .         .         .         .  g.10584
ggtgccatgtgatgagcctgccaaggtctcacctcctagggcccagggcctggatctgag  c.830+300

         .         .         .         .         .         .  g.10644
aatttaagggggatgcttgctgccttccctgtgcctccccggaaacagacggaagccccc  c.830+360

         .         .         .         .         .         .  g.10704
ctcaaagctctactggaaggaaatgggggatgaggcctgcagatgtgactcggctatcca  c.830+420

         .         .         .         .         .         .  g.10764
ccatctgccagatctggtgggacttctctggggctgggttcttaagtgtcagcagaccca  c.830+480

         .         .         .         .         .         .  g.10824
gcctgtctgggagacccttccatctgtcctttcattcatccaaccaacagtgacacttgg  c.830+540

         .         .         .         .         .         .  g.10884
ccaaatatgtgtcaggccctacatgggatcgggtcatcagctagtgtgagctgaggggaa  c.830+600

         .         .         .         .         .         .  g.10944
gggagaggaacttaagcatcagccaggagtgcagagaagggctttgtgaaaggcaggatc  c.830+660

         .         .         .         .         .         .  g.11004
attcactgaaagacatacacgcagctcttggagtccagcagaaatgagttcaagaccagc  c.830+720

         .         .         .         .    g.11046
tgtggaactgaccagcatgaaacctcagggaagttacttaat  c.830+762

--------------------- middle of intron ---------------------
       g.11047      .         .         .         .           g.11088
       c.831-762  ctctctgagcctctatttattcctctttaaaaaaaaaaaaaa  c.831-721

.         .         .         .         .         .           g.11148
atgtcaggggttgggggcaaggggagggacaacgttaggagaaatatctaatgtagatga  c.831-661

.         .         .         .         .         .           g.11208
cgggttgacgggtgtagcaaaccaccatagcacgggtatacctatgtaacaaacctgcac  c.831-601

.         .         .         .         .         .           g.11268
gtactgtacatgtatcccagaacttaaagtataataaaaaaaataaaaatataagacttt  c.831-541

.         .         .         .         .         .           g.11328
taagattcaaaagaaaaaaatgtcagggtttggggtagcagttcaggctgttggaaggat  c.831-481

.         .         .         .         .         .           g.11388
taagtaagagaatgtaggtactgtgcttggtacattgcataggctcaagaaaccttagtt  c.831-421

.         .         .         .         .         .           g.11448
ccctccctactctccaacattcatgcaattggctgaggactaactagtaatgacagcttc  c.831-361

.         .         .         .         .         .           g.11508
cgtttaatgagtgccttctatgtgacaggcaccatccttaatcctcacaactctgaggta  c.831-301

.         .         .         .         .         .           g.11568
gctattactttcttcacttcaaagttgaggaaactgaggttcagagagggtaaggcattc  c.831-241

.         .         .         .         .         .           g.11628
acccaaggtcacacagccagagagtaactaggccaggatggccacccaggtttctcagat  c.831-181

.         .         .         .         .         .           g.11688
tccacaagaccctcgcacgtctgtaattcctgacttccgtgctcacttcaatggacacct  c.831-121

.         .         .         .         .         .           g.11748
tctcattcccttctctttcacctccaatcccatagagcctctcaccaggggtggggggct  c.831-61

.         .         .         .         .         .           g.11808
tggggtgggctcaggacccagtcagaggttcggactctcaggggctttctctttcttcag  c.831-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center