forkhead box N1 (FOXN1) - 3485 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.11965
gtgagcccaagattcctccccatcccatcacccccaagtcctggacaggccaggcctctc  c.927+60

         .         .         .         .         .         .  g.12025
tgagcagaggcttctgtctggaggtgggagaagaattagaacgaaagccaggagagggct  c.927+120

         .         .         .         .         .         .  g.12085
tacccccaccatgctttccgttgtctccacctcagaaggacagagttcctacaaaaggtg  c.927+180

         .         .         .         .         .         .  g.12145
ctccaagtggggaacagagagcccaagtggctcatccaaggttgcacagcagactggagt  c.927+240

         .         .         .         .         .         .  g.12205
cagaccttctgctggggaaggtgggcaaggtagcaccgatgggcctcagggagcatccac  c.927+300

         .         .         .         .         .         .  g.12265
ctaccccaagtgggaagagaaagttggagaagaaataagacactattgctaccccgaccg  c.927+360

         .         .         .         .         .         .  g.12325
ctgggatgctgtggggctggagaagctagtcagccacggtgactgggaggtcggggctga  c.927+420

         .         .         .         .         .         .  g.12385
agaagccattgccttccaaggtgagattaggatctatctctgtgggtggcaggctcagct  c.927+480

         .         .         .         .         .         .  g.12445
gcagttctgccagaaagcggggtgtgggcttcccagtctttgagtgtcccaggctggctc  c.927+540

         .         .         .         .         .         .  g.12505
acctgactctcccccaaccccttgggcagaatctcatttctatcattcacagaaggcgct  c.927+600

         .         .         .         .         .         .  g.12565
tctgggagccttacccagctccctctctagaggcaggacaggggctcttctcccaaggtg  c.927+660

         .         .         .         .         .         .  g.12625
gacaaacacatcagacagggtggtccattcccctaaggtcgcacagtagatgggatcagt  c.927+720

         .         .         .         .         .         .  g.12685
tactggatcaagctatttggctttgcacacccctctctgcgtgccacctagaccctccag  c.927+780

         .         .         .         .         .         .  g.12745
cacagacccccttctcctgggatgggtatcagggagaccagagattgtgtgtgaggagtg  c.927+840

         .         .         .         .         .         .  g.12805
ccttctccaagccctagtagacacaaatctcatctgtcacccaggcagtgggcagttgct  c.927+900

         .         .         .         .         .         .  g.12865
gagacccgggtaatccagaactcagctccacctgccagggggtgattcctgcccccacca  c.927+960

         .         .         .         .         .         .  g.12925
tctatggtcctgcctggggataatttgacgcttgatgttcaaataagtttatcctgctgg  c.927+1020

         .         .         .         .         .         .  g.12985
gctgccatcagatgaggagtgggcaagttggccggagtggtctgtccaggagtggaaaag  c.927+1080

         .         .         .         .         .         .  g.13045
tgtgttgatccaccagaggttctggaagggaaagagggagggaggtgagtcgtccctgga  c.927+1140

         .         .         .         .         .         .  g.13105
attcaagaagcatcaaagcctgaattcagggctgccctccataccccagcaggtcagggg  c.927+1200

         .         .         .         .         .         .  g.13165
ctgaactctccctaacccctaaagcttttggagggtcttctagggtttcaaggggccagg  c.927+1260

         .         .         .         .         .         .  g.13225
gcagagagagggaaaagcccagtcctctcagccttccttccccaccagctcccggcctgg  c.927+1320

         .         .         .         .         .         .  g.13285
cccccacccctccccgcatctcatcttcctggcttaattatttttcctgggagccatgta  c.927+1380

         .         .         .         .         .         .  g.13345
atccctgttttatggggctgaggagtgaagaggtctaacagctttttgttccctttggtt  c.927+1440

         .         .         .         .         .         .  g.13405
ctagttgttgcttttagccacttgcatcactccctcactcctgagtttacatttgatctc  c.927+1500

         .         .         .         .         .         .  g.13465
agagagaaagcatctgtgaggatgggatgggccccagattgtgaggcaggccctatgggg  c.927+1560

         .         .         .         .         .         .  g.13525
tgacctgggcagggcccttagctgggggacagagttggaggctaagctctgtcactgcct  c.927+1620

         .         .         .         .         .         .  g.13585
ccttgtgtgatccagggctaggccctttcttctctgaacctcagtttcccagtctgtaaa  c.927+1680

         .         .         .         .         .         .  g.13645
gtgggtcagatccgttggcacatagattccttctgactctgacagttcccctgtgaccca  c.927+1740

     g.13648
cct  c.927+1743

--------------------- middle of intron ---------------------
                                              g.13649         g.13650
                                              c.928-1742  aa  c.928-1741

.         .         .         .         .         .           g.13710
ggaaattccttagttcaaagatcccccacctctttccatctctcacttcccttttgaaga  c.928-1681

.         .         .         .         .         .           g.13770
tcatttttctgggcaaggatagactggaccctggagtggccagcactcatgcccaaggca  c.928-1621

.         .         .         .         .         .           g.13830
gctgctgtgggcatcccatagccccatgagtcagggatgtggggctggggaagtgtccag  c.928-1561

.         .         .         .         .         .           g.13890
ccactggacataattgttagtgctgaccatccctcttccaaacaggaagtggctggggtg  c.928-1501

.         .         .         .         .         .           g.13950
ggggctgccctggcatcccaaagtcacagattcatggggccataaaaggccccagcgccc  c.928-1441

.         .         .         .         .         .           g.14010
attaactccgcccatggggcaacgtggccttaactcctagtggagactgtggtgggagtc  c.928-1381

.         .         .         .         .         .           g.14070
gaaggtgaatccctagttggctggtctggtggctcaagaatcctccctggtgaccctggg  c.928-1321

.         .         .         .         .         .           g.14130
agccttaggggtcatctcaaccagcaacctgccccaggccagctgcccccaagaaaggct  c.928-1261

.         .         .         .         .         .           g.14190
gcaccaggtcctgccagccacttggagtgacgctggcatcaagacccagttctgctgggc  c.928-1201

.         .         .         .         .         .           g.14250
atgattcagcttggctgctccctggggcaagtgagctgaggaggaaggagtggccgcccc  c.928-1141

.         .         .         .         .         .           g.14310
tcattaagcagaaactttgggctgaaagggggaggggccagggaatgagggcgaaggagc  c.928-1081

.         .         .         .         .         .           g.14370
cccaccggccagagcgagtgccctacccacagtcagcccctgctgaactcagggctgtca  c.928-1021

.         .         .         .         .         .           g.14430
cagagcctggaacagagctggaggtgggcgggcagggggcccactggcactcccgccacc  c.928-961

.         .         .         .         .         .           g.14490
gcctctcacccaactgagtcagcctaatggtttttacaaccctccctgggcacaattacc  c.928-901

.         .         .         .         .         .           g.14550
acactggtggcatgaccaggcctcctaatgggtgtttattctattggcacgagcaccccc  c.928-841

.         .         .         .         .         .           g.14610
ccccactgcctgagggctggcctccccaccagggcacgccccctgggcacactcatgcaa  c.928-781

.         .         .         .         .         .           g.14670
acactcacacccacacatcatacgatcatggctacccacagtcacacccagagagacttt  c.928-721

.         .         .         .         .         .           g.14730
ctcacacacagccatcctcacagtcgaggaattcatggacccatgaaggagtatccagga  c.928-661

.         .         .         .         .         .           g.14790
gacgttgcttatgccaggatgacacacttagggacgtatgcacatgctcatacgcactgt  c.928-601

.         .         .         .         .         .           g.14850
cccttcatataccaaacccacttagacacacaaacatatgtgcaatgcacacaccgcaca  c.928-541

.         .         .         .         .         .           g.14910
cacccaaacactcaccaacctcgcccatctttcttttctcccaagttagtcccagagggg  c.928-481

.         .         .         .         .         .           g.14970
ataaggcagacccaggagaggagcattcttcccctaattcccctgtctaaagccagccac  c.928-421

.         .         .         .         .         .           g.15030
aagacctcagagtaatgagtcccccttccacagaggggtccaagcacaggcatggagacc  c.928-361

.         .         .         .         .         .           g.15090
cagtggggagtggctcagcttcagatgggagagtgttgtgggtcagaaggcctctgtagc  c.928-301

.         .         .         .         .         .           g.15150
gcccaccagccctggctttccgaatcacctcggcagtcctctgaggggtcaggaagggat  c.928-241

.         .         .         .         .         .           g.15210
gcgggtgggatgaaggcagatttgagatgaaaataacttggggtcaaggttcctgttcac  c.928-181

.         .         .         .         .         .           g.15270
ccgtcccctaccaccaaagggtaccaagcaagggatgggtgctgaggaggacaacaagcc  c.928-121

.         .         .         .         .         .           g.15330
ccagagtgggcggcagctctgtgcccagaggagaaacaggagtgttctagaacccagacc  c.928-61

.         .         .         .         .         .           g.15390
tgaagcccgctctggcttcctgagcctggcctgaatgcttgtcttgctctgttccggcag  c.928-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center