forkhead box N1 (FOXN1) - 168 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.15658
gtgaggccggccgggccacgcaaggaagggcccagggtactcatgagccaaaaaaaaaaa  c.1135+60

         .         .      g.15682
aaagagagaatcagagaatgaggc  c.1135+84

--------------------- middle of intron ---------------------
                         g.15683        .         .           g.15706
                         c.1136-84  aaggccccgagtaagggttccagt  c.1136-61

.         .         .         .         .         .           g.15766
ctggggaagactgtggaggagggaggtctcatggtgttctttctctcttgggcctttcag  c.1136-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center